Victoria Schattauer, 21 år gammal och är i en period i livet då hela livet känns väldigt starkt. Här delar jag med mig av min vardag (färgglad som grå), mitt skrivande och en hel bunt i fotoform. Kram!

TRE TIMMAR SENARE..

Nu har jag pluggat klart! Förstår mycket mer nu och jag hoppas verkligen det sitter i sig för jag har inte råd att förlora mer tid och behöva lära om mig. När morfar sitter bredvid mig har det en tendens till att gå super men när han bara såsom kollar bort går det åt skogen igen. Förhoppningsvis har jag dock blivit lite smartare ikväll! 

Nu ska jag avsluta kvällen med att skypa med Anna! :)
 

MATTE ÄR KUL MEN JAG FÖREDRAR ATT TRÄNA (?)

Tjoho kompisar! Nu är lilla viggo glad igen efter att ha klarat av den här nervösa dagen.
Ligger i sängen och kollar på min mage och leter efter lite progress, går sisådär ;) Mitt tålamod börja svikta, håll ut håll ut får jag påminna mig själv om hela tiden! På en månads strikt kost och två veckors (var sjuk) hård träning så har jag gått ner -6 cm i midjan. Väger fortfarande lika mycket som innan, mellan 55.5-56 kg, så har inte gått upp eller ner. Märker dock på kroppen att den fastat till sig lite trots att det inte syns på alla mått, som tex. låren. En liten omfördelning har nog skett men mindre har dem inte blivit för det. Vi får se, om två veckor ska jag mäta mig igen och se om det hänt något! 

Snart kommer morfis och pluggar matte med mig, det blir nämligen min sysselsättning för kvällen.
Gäller att ligga i lite extra eftersom jag inte har den där superhjärnan som många tydligen föds med..

DÅ VAR LIVET ANNORLUNDA

Ridlägret 2011 - ett minne för livet



VI KLARADE DET!!!!

Överlycklig, lättad och taggad på livet!


MITT HJÄRTA HOPPAR UR SNART

Känner mig verkligen så otroligt nervös, förstår varför men ändå inte. Försöker lugna ner mig själv men det går inge vidare bra. Ska ju bara prata i 15 minuter så jag förstår inte vad jag har att vara nervös för? Jag är ju van ju. Kirrade ju att vara i USA hela sommaren så vad är det att stressa upp sig för? Chilla nu Victoria!


DAGLIGA DOSEN

När man får chansen att träna innan skolan snackar vi lyx, att slippa folkmassorna är så skönt. Att sedan äta lax till lunch efter ett hårt träningspass är nästan ännu lyxigare. Nu kan jag inte riktigt tänka positivt trots att jag redan är klar med träningen för idag osv. med tanke på att jag har muntliga nationella i engelska om två timmar. Förstår egentligen inte varför jag är nervös men jag kan inte rå för det!!


YES SIR


Det gäller ju att vara diskret

Sitter på bussen och smygfotar mig själv för eran skull ;) klockan är nio (prick när jag skriver det här) och jag är på gymmet om knappa tio minuter. Idag är det axlar som står på schemat! Har gott om tid på mig innan jag börjar skolan så jag kommer köra 10 set på alla övningar, tar mest!


Preworkout frukost:

Nu bär det av mot gymmet!


BLOGGAR JAG LÄSER

Jag är bokstavligen beroende av att läsa bloggar och jag läser många dagligen.
Här kommer en lista på de bloggar jag läser både träningsrelaterade men också vanliga:

annainthestates.blogspot.com
svettlukt.myshowroom.se
blondinbella.se
rebeckarakell.devote.se
younghammer.blogg.se
petrametromode.se
fannystaaf.se
improveme.se/fitspooration
gaybloggen.com
hannaoliviabergman.blogg.se
htabrizi.blogg.se
kenzas.se
micksy.blogg.se
linneatheodorsson.myshowroom.se
lisapt.se
nyheter24.se/modette/chloeschuterman
zarish.blogg
blogg.veckorevyn.com/ptfia/
fightingtogetfit.blogg.se
ingridkatarina.wordpress.com
letsgethealthy.blogg.se
pemmis.blogg.se

Q/A

Postat av: Anonym

Jag vill gå ner i vikt men jag förstår inte när folk säger att man ska tänkapå kalorier in och ut? Alltså om jag äter 1500 kcl per dag kan jag väll inte bränna 1500 kcl för att gå ner? Eller??
 
Svar: Jo, för att gå ner i vikt måste du göra av med mer än du får in. Alltså, du måste ligga på ett kaloriunderskott.  Hur mycket du förbränner varje dag är upp till var och en, det beror på hur fysiskt aktiv du är. Äter du nyttigt och tränar regelbundet så sköter kroppen resten, det innebär inte att du ska sluta äta. Kroppen behöver energi för att orka om man tränar mycket tex!

Postat av: S

Kan inte du snälla skriva ett inlägg om ALLA bloggar du läser? Inte bara träningsbloggarna, utan alla andra också! Även dom du kanske bara läser nån gång ibland, vill ha ALLA! :D haha behöver lite bloggtips! Kram!
 
Svar: Absolut, det kommer upp snarast! :) 

Postat av: Emelie

Hej finaste du! Jag har precis bytt gym och börjat på Sats i Sollentuna, är så sjukt taggad på alla gruppträningar!! Men jag ser att jag bara kan boka 10 pass/15 dagar, och sen är det väldigt långa väntelistor. Hur kunde du träna så mycket pass som du gjorde? Har du nått tips? JÄTTEKRAMAR!

Svar: Vad roligt, då stöter vi förhoppningsvis på varandra! Förstår att gruppträningarna lockar, dem är underbara :) Precis, det finns en maxgräns på hur många klasser man får ha bokade, väntelistorna är som du säger dessutom väldigt långa. Jag fick ihop det på något sätt ändå, De passen jag verkligen ville gå på hade jag alltid bokade så som. cykling på måndagar och tisdagar, powerstep på torsdagar och möjligtvis 2-3 andra klasser i veckan. Det fungerade! Eftersom det är lika för alla så jämnar det ut sig på något vis, det är dessutom väldigt många som avbokar deras pass dagen innan/samma dag vilket gör att trots att man är på väntelista så får man plats! Men de populäraste passen får du helt enkelt prioritera att boka om du vill få plats på dem ;)
 
Postat av: Mallo

jag ska börja på nytt gym eftersom jag inte trivs med det jag går på nu, så.vad tycker du om att skaffa en PT där på de nya då jag aldrig varit där? bra? dåligt? :) skit grym blogg bästa träningsbloggen som är enkel att första. :) puss

Svar: Om du vill ha någon som guidar dig i början, då allt är nytt och en omställning så kan du självklart ta hjälp av en PT, givetvis också om du vill ha personlig coaching. Men något att rekommendera är att boka en timme med en PT för att ta en runda på gymmet och lära dig hur allt fungerar osv, det är en bra start! Få tips osv, lägga upp en träningsplan om det är det du är ute efter :) Självklart är en PT inte dåligt, en hjälp på traven!

 
Postat av: Emilia

Hur mycket kostade jeansen? :) 
Riktigt snygga!!

Svar: Tack så jätte mycket! Båda var nedsatta från 700 kr till 169 kr/styck.  

Postat av: Elin

Vet du vad det är för skillnad på vit quinoa och svart o röd quinoa? Är den onyttigare för att den är vit?

Svar: Är inte så påläst men jag vet att svart och röd quinoa innehåller mer fibrer men annars är de snarlika!

KVARG OCH BÄR


Delikatess! Nu är det dags för mig att hoppa ner i sängen och sova, förhoppningsvis kan jag sova i natt! 
Imorgon är det en lång dag som startas med ett gym besök, kan det bli en bättre start på dagen? Godnatt!


RÄK&ÄGG-BLANDNING MED SALLAD


Improviserade lite ikväll! Gjorde en räk&ägg-röra (med peppar och salt som kryddor) och hade som topping på min goda sallad (spenat, isberg, paprika, avokado och gurka). Blev super gott, testa det! :) 

ATT SATSA ÄR MITT ENDA VAL


Mina ben är fullkomligt katabola.. Skön känsla! Kan knappt stå på dem efter benpasset idag,
precis som det ska vara! Vågar inte ens föreställa mig träningsvärken imorgon ;)

Var verkligen fullproppat på gymmet idag (som vanligt nu för tiden) så schemat går inte riktigt att följa i rätt ordning eller köra superset på allt eftersom man inte kan paxa flera maskiner samtidigt. Suger men det avtar förhoppningsvis snart! Sitter med Emma nu i min säng som jag mötte upp efter träningen, skönt med lite snack med personen jag verkligen kan prata med allt om, då menar jag verkligen allt.

KOMMER INTE PÅ EN RUBRIK

Inte ens vad jag ska skriva ;) håller på att döda benen nu iallafall, marklyften är de värsta! Dags att fortsätta :))


JAG OCH MIN NYA SHAKE


ENGELSKA NATIONELLA - CHECK

Stressade mig igenom sista delen, känns inte bra alls. Onödigt av mig, aja livet går vidare. Nu ska jag på ett möte och sedan är det leg-day för fulla muggar! Svarar på era frågor senare ikväll, har rullat in en hel del men hoppas jag hinner svara senare!:)


Onsdag morgon

Och allt flyter på precis som vanligt! Nu är det 3:dje dagen i rad jag inte kan sova normalt, verkligen jätte irriterande. Aja, det blir väl bättre!

Bara jag som är glad för plusgrader förresten?


#WORD


KVÄLLS INSPIRATION


Alla dessa dåliga iphone bilder

Min kamera på min telefon är verkligen i det sämsta skicket nu. Snart har jag haft den i två år och jag vill verkligen ha en ny snart, inte för att det är något fel på den men jag har bara tröttnat. Känns lite fel att klaga men ni vet, man är aldrig riktigt tacksam för det man har. Fast något jag är tacksam över är min kvarg som jag ligger och gottar mig med i sängen. Att nyttigt kan vara så gott, det är det ingen tvekan om! Börjar bli lite nervös inför benpasset imorgon men det ska nog gå vägen precis som alla andra onsdagar ;) Kommer dock tyvärr inte kunna börja träna innan fem tiden, har nationella innan och sedan ett möte inbokat så det blir en sen kväll, jobbigt nog. Men det ska jag nog klara av :) 

Godnatt!

KYCKLING GRYTA MED BLANDSALLAD




- MIN SHAKE HAR ALDRIG VARIT SÅ EFTERLÄNGTAD -


Tro mig ;) Core passet var till och med så jobbigt idag så att det rann svett över hela mig under passet, brukar vanligtvis inte göra det eftersom det är styrka. Men idag, ja, när jag tog den lila vikten så! Vill bara påpeka för er som tränar på sats (ni andra också), som ni vet finns det gula, gröna, oreanga och lila viktplattor. Många har tendens till att ta för tunga vikter på de flesta övningar. På en ryggövning som är med i programmet på satscore så rekommenderar instruktörerna att man använder sig av en gul eller grön vikt. Jag påstår mig inte vara svag, men jag väljer ändå att inte ta en vikt, det är tillräckligt jobbigt som det är. När jag då kollar mig runt omkring ligger de flesta ner helt utmattade och orkar inte göra någonting alls, de utför då inte alls övningen för att de inte orkar. De kanske gör 2-3 stycken istället för att kunna göra alla utan vikt. Många har svårt att förstå att det är bättre då att lyssna på kroppen och ta ner vikten och utföra övningen, det är mycket bättre än att göra ingenting alls! Om man då istället väljer att göra övningen utan någon vikt orkar man då istället utföra övningen, och tro mig det är ändå pissjobbigt! :) Bara ett tips!

Hoppas ni har haft en lika bra tisdag som jag!



READY TO KICK ASS!

Är ni med mig?


I COULD BE THE ONE

Pumpar musik i öronen på högsta volym och börjar tagga till riktigt rejält! "I could be the one" med Avicii är min favorit träningslåt just nu, skulle kunna springa tusen mil med den i öronen känns det som, haha.

Hörs senare finisar!


Preworkout mellis:

Råris, kalkon och keso!


Känns som måndag fast det är tisdag ;p;p;P;p


För att ha sovit så lite som jag gjorde i natt (sov antagligen dock mer än jag tror) så är jag hyffsat pigg. Har sedan jag kom hem vid två bara tagit det super lugnt, sånt behövs verkligen ibland. Jag fick precis ett brev från folktandvården med en kallelse, men jag är ju så fyndig så att jag ska gömma den innan mamma hittar den. De kan bara glömma att jag skulle gå dit på allahjärtansdag, en tisdag samma tid som mitt cykel pass är.

Nu håller jag på att koka lite ris, sedan är det preworkout som gäller :) Taggad på cykling + core ikväll!! 

FEELING GOOD

Hungern börjar krypa sig fram lite smått.. Lunch om 1 1/2 timme! Men innan dess ska jag genomlida ensamble lektionen där jag faktiskt tror jag kommer dö, har en läxa till idag jag helt glömt bort. Hoppas jag överlever!

Om 4 veckor är det periodsbyte i min skola, kommer få mycket bättre schema så jag kan knappt vänta!


Sömnlösa nätter

Jaha, ännu en nattdå jag inte kunnat sova! Bokstavligen hatar det.. Tur att det är en kort dag i skolan iallafall. Sedan får jag väl åka hem och ta en tupplur eller något om jag ska orka med träningen ikväll!


BRA START PÅ DENNA VECKA

Det har jag haft iallafall, hoppas ni känner samma sak! :) 
Nu ska jag släcka lampan och försöka sova innan jag börjar tänka, fundera och analysera för mycket.. Farligt att vara mig! Så fort jag gör ingenting strömmar det tankar överallt i mitt huvud. 

Den här bilden togs för två år sedan idag. Jag och min lilla misse. I övrigt har så sjukt mycket saker förändrats,  jag kommer i chocktillstånd när jag tänker på det. Jag gick i nian och hade ett helt annat liv känns det som.

MYSISARNA ÄR PÅ

 
 Sedan jag kom hem från träningen har jag rensat i mitt rum. Rensat och lagt undan kläder jag inte använder osv. Känns skönt nu efteråt och efter en varm dusch känner jag mig typ fräschare än någonsin haha :) 

Och kan måndagen sluta bättre än med top model? Bra start på veckan helt enkelt!

NEW IN - DAGENS SHOPPING

Fick med mig en hel del saker idag och jag har verkligen en bild i huvudet på vartenda plagg, hur jag ska bära det och när jag ska använda det. Jag är så himla glad för allt det jag kapat idag! Här kommer lite urkassa bilder på kläderna. Måste se till att ladda min systemkamera så jag kan börja bjuda på lite bättre kvalité bilder framöver, hehe. Men jag är tacksam att jag har min iphone ;)

Linne från hollister

Aprikos/ljus rosa kavaj från h&m

Flanell skjorta från hollister (lite bagie)

Boot cut jeans från hollister

Boot cut jeans från hollister

Mjukisbyxor från hollister

Sportbh från h&m

30-20-10 cyklingpass - mjölksyra på hög nivå

Det absolut jobbigaste och bästa cyklingpasset har jag nu genomlidit! Det bygger på 30 lätta sekunder, 20 riktigt jobbiga och 10 sekunder då man vill dö. Otroligt intensivt och absolut det absolut bästa!

Innan cyklingen genomkörde jag bröst, biceps och mage. Idag gjorde jag 240 situps i maskin vilket känns super! Efter drygt två timmar på gymmet var jag helt slut, skönt att mamma slutade på jobbet samtidigt så att jag fick skjuts hem! 

Patricia tyckte också det var väldigt jobbigt!

;)


17 ÅR 17 ÅR I STADEN

Har haft en så mysig dag i stan med Sanna! Vi åt god lunch i gallerian, var inne på hollister ett bra tag och gick även till lite andra affärer, bla. Urban outfitters! Fick med mig massor av fint hem som jag kan visa ikväll! När man inte shoppar så ofta får man passa på! ;) nu är jag på lá gym och har kört i drygt 1 1/2 timme. Snart cykling!


Ett sätt att spendera dagen på

Har haft ett sånt sug på att åka till hollister de senaste dagarna så det ska jag och Sanna göra idag! Har packat alla mina saker nu och är påväg till tåget :) ha en bra dag hörrni!


Mysmorgon i min takt

Jag är kär i mornar då man kan gå upp när man vill, äta frukost hur sakta man vill och ha kvar pyjamasen på hur länge man vill. Underbara dagar! En sådan är det idag, det är z-dag på rudbeck idag vilket innebär att jag är ledig från skolan idag. Otroligt skönt!

Därför ska jag idag göra lite roligare saker än jag vanligtvis brukar på måndagar. Nu, ska jag snart göra i ordning träningsväskan, för sedan ska jag träffa Sanna innan det är träningsdags. Har gott om tid att gå igenom bröst/mage/vader idag eftersom jag kan börja tidigare än vanligt (eftersom jag annars slutar 4) för vid 6 börjar cyklingen!


TOGETHER WE WILL MAKE IT COUNT


MUMMA


Q/A

Äter du ALDRIG onyttigheter? Spyr du iblqnd? Grym blogg för övrigt!!

 Svar: Nej, inte nu när jag tränar såhär. Unnar mig ingenting under mina intensiva träningsperioder då jag försöker nå ett mål eller liknande. Under jul unnade jag mig dock en hel del och i sommras nrä jag var i USA! Nej jag spyr nästan aldrig ;) Tack så jätte jätte mycket!
 Åh snälla kan inte du lägga upp bilder på gröterna (?) du äter? Fiber? Quinoa?

Svar: Yes, jag äter fiber och quinoa gröt!

Vilka märken köper du? 

Svar: Saltå och frebaco!

Men brukar inte du träna med träningsvärk?

Svar: Nej, har lagt ner det nu när jag vet hur mycket skada det gör på kroppen. Om jag har träningsvärk i benen tränar jag isåfall en annan muskelgrupp vilket är fullt vanligt för att vara mig, har oftast träningsvärk efter mina styrkepass men eftersom jag tränar olika muskelgrupper varje dag under en vecka (går i genom hela kroppen på 7 dagar) så fungerar det utmärkt!

Härligt med mat i magen!

Det här är min favorit mat av alla mina favoriter! Kycklinggryta med oliver i + sallad.
Nu ligger jag i soffan och tittar på taken, ska snart hoppa in i duschen så jag blir lite fräschare!


MAN FÅR DET MAN FÖRTJÄNAR

Vad skönt det är att äntligen vara tillbaka på banan med söndagarna igen! Värmde upp med att springa 4 km till träningslokalen (okej, värmde upp och värmde upp haha). Idag sprang jag med ett par craft byxor över mina casall byxor vilket var helt perfekt. Inte för kallt och inte för varmt!

I allmänhet var träningen väldigt bra, känner mig otroligt mycket starkare, speciellt i armarna! Vi gjorde en hel del nya bra övningar som jag skulle kunna filma/ta kort på om ni vill ha inspiration?


Taggad!


NEW IN

Har varit och kollat på möbler/speglar till mitt rum idag med mamma. Hittade en fin spegel som jag kanske kommer köpa, kom dock hem med de här mystofflorna, dem är gigantiska :) nu håller jag på att tagga till för träning!


Lunch dags!

Åkte till solletuna och fikade med Jenny vid tolv tiden och nu har vi precis kommit hem till mig och ligger i min säng och chillar! Åt jätte god räksallad till lunch idag alá moa! :)


HEJ ALLA VIGGOS KOMPISAR

tjo alla viggos 100000000000 läsare! Hoppas att ni alla mår lika bra som jag gör :D dagens händelse är att viggo precis gjorde sönder hennes älsklingsbyxor (HAHAH, lite skadeglädje på det) nej men hon är söt ändå. Har inget annat att säga nu... så ha en superduper bra söndag PÖSS! //the one and only, Jenny B
 
 

I wanna scream and shout and let it all out

Bra söndag när man lyckas sova till nästan tio, har inte sovit så länge på väldigt väldigt länge!
I övrigt gick jag upp och gjorde en jätte god frukost när jag vaknade. Kaffe-fiberhavregrynsgröt med keso och hallon. Kan inte beskriva med ord hur god den är, helt seriöst! Ni måste verkligen pröva :) Avnöjt verkligen av frukosten till tusen. För det första skulle jag kunna äta upp hela kesopaketet för jag har verkligen blivit beroende av keso, för det andra smakar gröten så mycket bättre om man smaksätter den med någonting (kan vara, ägg, kakao, kaffe eller tex. kanel) och för det tredje blir combon så himla perfekt god. 

När jag gör min gröt brukar jag göra såhär:
1 dl fiberhavregryn eller guinoahavregryn
2 1/2 - 3 dl vatten
3 msk nybryggt kaffe (svart)

Kaffe är väldigt bra för att sätta igång förbränningen och gröt är en perfekt frukost när man tränar mycket/är aktiv. Mitt favorit mål på dagen!

 


MIDDAG:


Lammgryta med sallad! Är helt fullkomligt död så jag stannar hemma ikväll, skönt.

Q/A

HEJ VICTORIA !! Jätte fin blogg och jätte inspirerande och den får mig motiverad . Men som alla nybörjare så har jag lite frågor och skulle uppskatta jätte mycket om du tar dig den tiden att svara på dom. 

Jag har precis fyllt 16 år och går i gymnasiet. Efter ny år så lovade jag mig själv att börja träna och i tisdags så köpte jag Äntkligen gymkort på sportlife. Jag ska börja på måndag ny vecka ny dag och allt sånt. 
Men grejen är den är att jag aldrig har gymmat innan och har ingen anning om hur jag ska göra. 
Jag är 1,55 cm lång och väger 65 kilo vilket är lite för mycket och jag är inte nöjd överhuvud taget och jag känner mig jämt osäker i shorts bikini och även byxor. Jag skulle vara jätte nöjd om jag klarade av att gå ner 10-15 kilo och för att göra det så kommer jag göra allt som står i min makt för att klara av de. 

Så så här ser min plan ut och undrar om den är godkänd? 

Kondition två gånger om dagen förutom lördag - söndag då jag vilar, sen så hemma träning ( styrka ) varje dag i en halvtimma? Låter de för hårt eller mesigt ? Och det som kan komma att hindra mig är tränings värken för jag har hört att man inte ska träna då men jag vill ju så gärna träna och är så sjukt taggad så hur ska jag göra då? Om jag tex springer konditon på måndag och får tränings värk på tisdag vad ska jag göra då? Ska jag skippa tisdagen och träna på onsdagen igen ? Eller ska jag träna en annan del av kroppen där jag inre har tränings värk ? 

Och maten. Jag är ett mat vrak och äter jämt över de jag ska göra så jag ska halvera mina mat intag , mindre kolhydrater och äta oftare för man ska väl typ aldrig gå hungrig ? :) 


Kanske en rörig text men jag hoppas verkligen att du förstod vad jag försökte komma fram till och att du tar dig till tiden att svara. Tack så jätte mycket :)

Svar: Tack tack tack tack det värmer! 

Vad duktigt av dig! För det första, gå inte ut för hårt till en början. Har du tex. aldrig tränat på gym, börja då inte med att gymma 6 dagar i veckan, superintensivt! Öka istället succesivt med träningen, starta med kosten och se till att den fungerar för och främst för om den inte fungerar då kommer träningen inte ge någon större effekt! 

Att träna kondition varje dag är inget att rekommendera, det räcker gott och väl med 3-4 ggr i veckan. Att träna kondition två gånger i veckan tycker jag inte du ska göra, satsa istället på ett intensivt konditionspass i 30-60 minuter. Det kan vara i form av intervallträning, cykling, ett konditionspass på gymmet, löpning, crosstraining, simning etc. Om du vill ha två vilodagar i veckan tycker jag du ska dela upp dem på två dagar långt ifrån varandra, möjligtvis söndag och torsdag? Har du tillgång till gym är det perfekt att träna styrka där, men givetvis fungerar det hemma också! När det kommer till träningsvärken: man ska inte träna med träningsvärk. När man har träningsvärk är det för att kroppen håller på att återhämta sig, dina muskelfibrer är helt sönderslitna. Det kroppen behöver då är inte ännu mer träning, den behöver vila. Accepterar du inte vilan så kommer dina resultat inte bli bättre, bara sämre. Du får helt enkelt spara på energin och använda den super intensivt när du väl tränar :) Om du springer på måndagen tex. och har träningsvärk så bör du fokusera på att träna en annan muskelgrupp dagen efter, för att kroppen ska hinna återhämta sig och vara 100% när du tränar den nästa gång! Känner du dig dock helt utmattad (vilket är helt normalt i början när man ändrar sina vanor/prövar nya träningssätt) så VILA. Men du kommer succesivt märka att när kroppen vänjer sig vid träningen kommer du inte få lika mycket träningsvärk. 

Eftersom ditt mål främst är att gå ner i vikt så ska du äta näringsrik mat, minska intaget av kolhydrater och satsa på protein och grönsaker. Det är viktigt att du äter regelbundet, på så sätt ökas din förbränning och du sätter igång viktnedgången (din kropp bryter då ner maten fortare och det kommer du märka på ex. dina toalettbesök). 5-6 mål om dagen är bra att ha på minnet, mindre måltider men oftare! 

Lycka till och hoppas allt går bra!


 

tjenatjena! tänkte bara ställa en kort fråga, eftersom jag har börjat träna och hållt på i cirka en månad nu. Men hur många kalorier ungefär bränner du på ett träningspass?

Svar: Det beror helt på! Under ett spinningpass på 30-55 minuter så är det mellan 350-550 kcal. När jag tränar styrketräning på gymmet i 2 h (intensivt och hårt) är det cirka 400-700 kcal. Olika klasser på sats som tex. powerstep, cirka 400-500 kcal. Men det beror som sagt helt på vilken träning jag utför! Kom ihåg att det är bättre att träna intensivt än att lalla runt på gymmet och träna halvdant i 2-3 timmar och tro att man är jätte duktig. Nu är ju mina pass längre, jag tränar fortfarande lika intensivt på dem, men varför dem är längre är pga. styrketräningen som tar tid. Men jag tränar fortfarande lika intensivt, men då gäller det att ha energi också! Idag har jag ont i hela nacken efter att ha tagit i så mycket igår på rygg passet ;) 

Jobb 1: check!

Har faktiskt varit en hyffsat rolig jobb-dag. Trots att jag var tvungen att gå till jobbet från centralen eftersom tunnelbanan strulade imorse). Men jag bemötte bara en otrevlig kund, det var inte allt för stressigt och jag fick mat i magen som jag ville! ;) Nu är jag påväg till städjobbet (går snabbt) och sedan hem för att äta en god middag med mamma. Måste vila mina ben lite, hela rygg/axel partiet är helt dött efter gårdagens hårda träningspass. Så det har varit en välförtjänt vilodag för mig efter hela den här veckan av intensiv träning och strikt kost (trots att jag gärna skulle åka till gymmet nu och springa 15 mil hehe). Nej men jag får vila upp kroppen inför imorgon då styrkegympan tar fart igen,! Ska bli extra kul eftersom jag antagligen kommer orka betydligt tyngre vikter, så kul när man ser framsteg!

Gud vad jag babblar :)


GÅRKVÄLLEN!

Var helt underbar! Den startades med tjejmiddag i lokalen som Ollie hade hyrt och sedan fortsatte den med fest hela natten. Dansade tills mina fötter dog och skrattade tills jag fick ont i magen! 

Invigde min kjol från berska (som jag köpte för 3 år sedan) och hade en blus från vila till det!


Kan inte sluta skratta åt den här bilden, ser verkligen ut som jag har puckelrygg..


Världens finaste 18-åring!


Och världens bästa räka!


Hemma hos Bergman när vi fixade oss!


Jag på toaletten med min kvarg ;) 


Sådärja!

https://cdn1.cdnme.se/cdn/8-2/586224/images/2013/pic_5102b94dddf2b351b16765c5.jpg" class="image">


Lunch:

På tal om ingenting så har jag blåsor över hela händerna, måste verkligen skaffa handskar för maskinerna. Hur som haver: dagens träning är klar! Krävande men ändå underbar. Har precis ätit upp min lunch (currykyckling med sallad) och nu är jag påväg till skolan. Har rätt bråttom efter skolan (eftersom jag slutar 4) så mamma kommer och hämtar mig då. Sedan ska jag bara hämta mina kläder och sedan hem till Bergman och fixa mig med tjejerna!

(Det här inlägget skulle postats för två timmar sedan)


I'm gonna make you sweat

Blev ändå en rätt tidig morgon ändå :) har inte kunnat sova så bra i natt men det är ingenting jag märkt av hitills iallafall! Kom till gymmet vid 9 tiden och tänkte pumpa på till halv 12. Rygg och baksida axlar är min favorit muskelgrupp att träna!

Har riktig energi idag!


Lets go!


MIN UNDERBARA 18-ÅRING

Idag är inte vilken dag som helst, det är Ollies 18-årsdag. Så sjukt vad tiden går fort. Att vi känt varandra i snart åtta år säger mycket! Du betyder mycket! Jag hoppas din dag idag kommer leva upp till dina förväntningar, du förtjänar det bästa! 

ALLA KAN OM MAN VILL

Ja, det är faktiskt sant. Äter man en pizza istället för att träna så är inte sanningen mer komplicerad än såhär: nej, du vill det inte tillräckligt mycket. Oavsett vilket mål man har, om man vill bygga muskler, leva ett hälsosammare liv eller gå ner i vikt så väljer man att avsätta tid för det man vill mest. Äter du pizzan så är det ett val, det är ett val som du gör och trots att du möjligtvis ångrar dig efteråt är det inte synd om dig så länge du inte gör något åt saken!

Ja, alla kan vi faktiskt om vi vill det tillräckligt mycket. Vill du bli mer vältränad ja då prioriterar du det framför dina gamla vardagliga vanor. Det kräver diciplin men jag lovar er, det är bara era huvuden som sätter gränserna! :)


Q/A

Jag har fått två liknande frågor om varför jag valt att träna på sats av alla träningscenter & varför jag lagt majoriteten av min träning på kondition. Tänkte passa på att svara på dem i det här inlägget!

Som jag gissar vet de flesta av er om att jag gymmar på sats, tyvärr har jag bara kort i sollentuna center men det fungerar ändå trots att jag helst skulle vilja ha i hela Sverige! (man kan ju inte få allt här i livet)

Varför valde jag då sats? Från början var det inte ett självklart val för mig men eftersom Ebba och Carro gymmade där så fick jag höra en hel del om hur bra det var och varför dem tyckte jag skulle välja just sats. Helt ärligt så visste jag knappt någonting, jag hade ju inte tränat på det här sättet någonsin i hela mitt liv. Men jag tror jag kände lite att, allt eller inget. I mina tankar fanns det där, för att hålla motivationen uppe och klara mig genom alla motgångar, alla jobbiga dagar så ville jag ha bästa servicen, bästa maskinerna, bäst av allt. Att gå till ett halvdant gym ville jag absolut inte då, jag trodde inte att min vilja var tillräckligt stark, att jag helt enkelt behövde det allra bästa för att ens komma någon vart! Friskis och svettis fanns självklart också lite i tankarna, men med tanke på att jag isåfall skulle behöva ta två olika bussar (byta en gång) så kändes det inte som det ultimata. I sollentuna centrum (där sats ligger) är jag i princip varje dag, så det är väldigt smidigt med bussar och tåg! Vi alla vet ju att det där med bussar kan vara en liten ursäkt till att kanske inte åka till gymmet en regning dag ;) 

Varför har jag då baserat mitt träningsupplägg på konditionsträning? Jo, konditionsträning innebär fettförbränning och fettförbränning innebär viktnedgång. Mitt mål var att gå ner i vikt och därför var intensiva intervaller i form av cykling, löpträning, crosstraining osv. det ultimata för mig. Men för att få en mer slimmad kropp (vältränad) så räcker det inte bara med konditionsträning utan det krävs inslag av styrketräning också. (Det är musklerna som stramar åt kroppen och gör en mer tight), därför har jag lagt om min träning och tränar hälften styrka, hälften kondition! Det är nu när jag gått ner de extra kilorna som jag vill börja forma kroppen och det är då man lägger på vikter :) Men som sagt, konditionsträning är förbränningsträning och genom sådan går man ner i vikt, därav startade jag med kondition i början eftersom mitt mål var att bli av med fett!  

Even though we're far apart you're always in my heart


Min irriterande katt

Jag älskar dig <3


PUSH IT


Ju längre tiden går så börjar jag tycka att muskler är snyggare och snyggare. Kolla min rygg, det börjar likna något! Hyffsat synliga ryggmuskler tycker jag är riktigt snyggt, något att jobba på! Börjar acceptera mina famsida lår allt mer nu också så det känns bättre, har alltid haft ett stort hat mot dem. Tråkigt när det blir så att man ska gå och tänka på oviktiga saker som egentligen bara gör en svagare. Är grymt taggad för pass imorgon, har sovmorgon till 1 så tänkte köra på riktigt bra på morgonen! 

MIDDAG:


Fantasin bara flööödar, (eller?) stekte upp räkor i vitlök och kokade ett ägg ikväll. Godis! 

Det gäller att ligga i!


Träningsvärken rumpa/lår börjar ta sig, benböj med vikt och raka marklyft är verkligen grymma övningar för rumpa/ben! Hur som haver, axelpasset idag gick hyffsat. Startade med uppvärmning på crosstrainern i 10 minuter innan jag började med styrkan. Kände mig tyvärr relativt svag idag, trots att jag klarade av att ta tyngre vikter än förra gången. Sega armar bara, otroligt irriterande. Men, jag känner mig ändå nöjd, jag gjorde mitt bästa för dagen och något mer kan jag inte begära av mig själv! Blev cirka 2 timmar sammanlagt men eftersom jag slutade innan kl. 2 så kom jag hem vid sex tiden ändå :D Så skönt att komma hem lite tidigare! 

Hej på er!

Vad skönt att sluta lite tidigare idag :) Har precis ätit mellis på gymmet och nu ska jag ta det lite lugnt innan jag börjar träna! Idag är det axlar på schemat, räknar med två timmar allt som allt och sedan bär det hem!


Godmorgon godmorgon

När jag inte kommer få mat i magen innan 12 tiden och äter lunch vid 7 krävs det en bra frukost! Fiberhavregrynsgröt, ägg, keso och hallon är det ultimata!


LÄGGDAGS


HELLO :)


Q/A

Postat av: Emelie

Vilka är de bästa klasserna på SATS? 
Vilka körde/kör du? 

DU är en grym tjej!

Svar: För det första: tack så jätte mycket! 


Nu går jag bara på cykelpass eftersom det är de enda passen som ingår i mitt träningsschema. Förut gick jag dock på flera olika såsom powerstep (var stammis varje vecka), satscore, shape, satscorepulse, yoga, pilates, shbam, crosstraining, gritcardio eller zumba. En bra blandning! Mina favoriter är gritcardio, satscore powerstep, shbam och givetvis cykelklasserna (45 eller 30 minuter). 30-20-10 cykelklassen som den nu jag nu går på måndagar heter är den bästa någonsin. Mest intensiv av alla cykelklasser på jorden tror jag (något i den stilen ;)). Fruktansvärt utmanande och underbart!


IDAG SAKNAR JAG USA


Herregud vad jag var lycklig på de här bilderna. Ta mig tillbaka!

PUMP IT

Mina ben är verkligen utmattade efter ett över två timmar långt benpass. Lyckades komma hem till sju tiden och nu har jag precis ätit min middag. Fläskfile med sallad! Ikväll ska jag verkligen bara ta det lugnt.
Har klarat av matteprovet och engelska nationella så det känns väldigt skönt!

Är dock ensam hemma vilket jag hatar :( är så tyst..


Just nu: benpass!


Havregrynsgröt frukost

Fiber havregrynsgröt, ett kokt ägg, keso och hallon blev det idag. Redo för en högst utmanande dag. Börjar med 2 timmar geografi! Längtar tills jag får åka till gymmet och lyfta bort all min ilska :)


LUGNA NER DIG NU


GAAAAAAAAAAAAAH, känner mig så stressad. Träningen gick bra och när jag kom hem började jag direkt plugga med morfar. Matteprov imorgon, engelska nationella (skrivdel) imorgon, geografi inlämning imorgon och samhällsläxa imorgon. Nu har jag fixat allt (hyffsat iallafall) så jag borde bara lugna ner mig men det är så svårt när man är uppe i varv. Har känt mig så stressad hela tiden nu så det är svårt att bara koppla bort. Allt får gå som det går imorgon bara, ingen idé att stressa över det! 

Men jag är fortfarande super stressad. Slängde i mig min middag fort som satan: köttfärsbiffar med sallad och sedan har jag sprungit runt i huset och lagat mat tills imorgon, packat träningsväskan, alla drycker, planerat kläder för imorgon, duschat, pluggat osv. Stressig kväll! Nu ligger jag äntligen i sängen och ska försöka avrunda. Svårt att hinna med allt ibland. Träningen kommer alltid i första hand vilket kanske ibland är lite fel. 

INVÄNTAR MITT PASS!


En helt vanlig tisdag

Fastän jag bara gick i skolan i drygt två timmar idag så kändes det som en evighet. Skönt att jag och Emma slutade samtidigt iallafall. Vi har fikat och kollat i butiker sedan två tiden och nu ligger jag i soffan på gymmet. Känner mig rätt seg idag av någon anledning. Hatar att känna så! Ska försöka få lite mer energi genom att inspireras lite av instagram och hälla i mig min preworkout. Det är inte min favorit att träna såhär sent, men det är skönt att morfar kommer och hämtar mig iallafall!


LITE MUSIK PÅ DET HÄR SÅ


Jag och min lilla älskling

Kändes ultimat att ta på mig min älskling idag! Mamma har rensat alla tjocktröjor/halsdukar/mössor osv. Så hittade bla. den här vita halsduken som jag hade glömt bort totalt! Nu är det ensamble som gäller :)


SOMMAR SOMMAR SOMMAR


Känner inte ni precis som jag att sommaren kan ta och komma.. just precis nu?
Längtar efter att kunna sätta på mig min levis shorts, bada, gå i linne, åka till Göteborg, åka iväg med mina bästavänner, åka till Österrike, få en paus från skolan, leva livet, äta glass i solskenet, springa i solen, eller varför inte springa i sportbh med mina nike pro's? 

OATMEAL WITH COTTAGE CHEESE AND RASPBERRIES


Vilken bra bild jag lyckades få till ;) Har fått min skönhetssömn i natt kan jag säga, så underbart! Vaknade dock när pappa kom in i mitt rum imorse och skulle ha pulsklockan.. Annars då? Jag kanske inbillar mig men nu har jag börjat märka skillnad på min kropp, jag hoppas verkligen inte det bara är en inbillning men när jag vaknade imorse och klädde på mig fick jag lite av en chock. Okej, haha överdriver kanske.

Skönt var det iallafall att kunna sova ut och äta frukost i lugn och ro. Fiberhavregrynsgröt med keso och hallon. Det här kommer bli en jätte bra dag! Har bara två lektioner, sedan ska jag fika med min efterlängda Emma och efter det väntar min favorit combo av satscykling och satscore med min favorit instuktör Malin. Har redan hunnit bli taggad av att bara packa ner träningskläderna och craze! :) 


Q/A

Postat av: Sara

Bara en random fråga, jag försöker att gå ner i vikt och träna minst tre gånger i veckan. Jag har en app i mobilen som räknar ut hur mycket kalorier jag äter varje dag därmed också hur mkt fett, kolhydrater och protein som jag ska äta. Jag brukar alltid lyckas vara under det jag ska ha per dag både på fett och kolhydrater men ibland är proteinerna mer än vad jag ska äta varje dag, kommer detta påverka min viktnedgång någonting?

Svar: Sluta räkna kalorier är mitt tips till dig. När jag räknat mina kalorier har det blivit exakt samma resultat för mig, men tro mig, det kommer inte påverka dig negativt. Det är bara siffror. Ät bara nyttigt, i bra mängder, små portioner 4-6 ggr om dagen och håll dig till bra livsmedel så kommer du se fina resultat. Kram på dig!


- JAG ÄR APAN SOM LIKNAR DIG -


Åh-herre-gud säger jag bara. Har fortfarande massor av energi i kroppen sedan träningen idag, adrenalinet bara flödar! Har fått en riktigt bra start på veckan måste jag säga, känns super. Hur har er måndag varit? Har pratat med Michaela (min syster) nu också en stund i telefonen och inga ord kan beskriva vad jag saknar den människan. Känns som att det är bra att vi är ifrån varandra ett tag för det är så vi nog kommer lära oss uppskatta varandra mer. Nu ligger jag iallafall i sängen, har packat hela väskan för imorgon, gjort allt mat, men.. tror ni inte jag glömt duscha? Fy-sjutton vad jag är äcklig. En riktigt italiernare känner jag mig som. Hehe. Gör det imorgon bitti istället! Sovmorgon för min del till 10.25! 

- JAG ÄR APAN SOM LIKNAR DIG -


Åh-herre-gud säger jag bara. Har fortfarande massor av energi i kroppen sedan träningen idag, adrenalinet bara flödar! Har fått en riktigt bra start på veckan måste jag säga, känns super. Hur har er måndag varit? Har pratat med Michaela (min syster) nu också en stund i telefonen och inga ord kan beskriva vad jag saknar den människan. Känns som att det är bra att vi är ifrån varandra ett tag för det är så vi nog kommer lära oss uppskatta varandra mer. Nu ligger jag iallafall i sängen, har packat hela väskan för imorgon, gjort allt mat, men.. tror ni inte jag glömt duscha? Fy-sjutton vad jag är äcklig. En riktigt italiernare känner jag mig som. Hehe. Gör det imorgon bitti istället! Sovmorgon för min del till 10.25! 

JAG SKRIKER AV GLÄDJE INOMBORDS


Så hela kvällen har jag och morfar pluggat matte. Har prov på onsdag så tog verkligen tag i det idag. Med vår mattelärare använder vi oss av en hemsida där vi gör uppgifter som han ser och när vi klarar av dem, olika övningar osv. så får vi gröna rutor i betygskriterierna, riktigt bra enligt mig! Hur som helst, har kämpat häcken av mig för att klara de 2 övningar man får gröna rutor för om man klarar. Man får inte göra fel utan måste få ungefär 7 st rätt i rad, (dessa är väldigt svåra och tar typ upp till en halvtimme att göra vardera) och nu, efter 3 timmar med morfar så klarade jag alla! SÅ LYCKLIG :D Känner mig riktigt nöjd, längesen jag pluggade såhär mycket! (hehe) Känslan!

UNDERSKATTA ALDRIG DIG SJÄLV

Gott med middag efter hård träning! Mamma hade tagit ut kyckling från frysen så det blev ingen mer komplicerad middag än så. Enkelt och gott! 


VARNING FÖR SNUSKIGA BILDER

Standard måndag! Biceps, bröst och mage gjord i styrke väg (1,20 h) och 30-20-10 (cyklingpass) i 30 minuter! Kände verkligen att jag tog ut mig på cyklingen, alla körde så galet hårt!

Fick sällskap hem av Jenny och nu sitter jag äntligen och äter middag!


Q/A

Hej hur tycker du craze funkar? har hört så himla mycket olika om den! vissa blir typ skit yra å helt skakiga och vissa ger den bara bra energi hur funkar det för dig? :) och kan du ta den typ på eftermidagen (runt 5) eller får man svårt för att sova då? tacksam för svar :)

Svar: För mig funkar craze utmärkt! Alla reagerar dock lite olika. Första gången jag tog den blev jag lite skakis men det har helt släppt, åtmistone vad jag märker av. Jag blir bara extremt pigg av den, vilket är underbart! Jag brukar ta den vid 3-5 tiden och det hinner absolut lägga sig tills man ska sova!

FRUKOST:


Fiber havregrynsgröt, keso, hallon, ett ägg.

Q/A

Postat av: Anna Petterson
Bara en liten fråga, har du sänkt din max puls mycket sedan du började träna? och hur vet man vilken maxpuls man har? Hoppas du får en otroligt bra vecka med massor av träning! för det ska jag ha! :)

Svar: Jag vet inte exakt vad min maxpuls är. Alltså när jag skrev att jag hade 188 i maxpuls idag under träningen så var det för att det var max som jag nådde idag. För att räkna ut maxpulsen kan man ta 220 minus sin ålder, men då blir det inget exakt, bara på ett ungefär. För att ta reda på den exakt så får man helt enkelt maxa, tex. springa så man är helt död och har sjuukt hög puls, och sedan när man inte orkar mer spurta ännu mer, då maxar du totalt! Detsamma till dig, den här veckan kommer bli magisk! Kram

SÖNDAGSÅNGESTEN ÄR HÄR

Alla känner vi av den då och då. Av olika anledningar men kanske främst för att måndag innebär skola och skola innebär plugg. Nu för tiden är söndagsångesten inte likadan för mig som den var förut. Jag vet inte vad det är men, jag kan inte sätta fingret på det, men det är någonting som ger mig såna grova ångest känslor. Speciellt, på kvällarna. Det handlar inte om att jag inte vill ha måndag för jag är och brukar vara otroligt taggad för vad den nya veckan har att erbjuda MEN det är just det där med att jag känner att jag borde göra bättre ifrån mig i skolan. Bättre än jag gör. Jag vet att jag har omprioriterat mitt liv. Något grovt. Och jag vet att det delvis är fel att jag lagt skolan lite åt sidan samtidigt som jag istället lägger all min energi på träningen. Jag vet att det är fel på ett sätt men jag känner mig verkligen så omotiverad på alla sätt och vis. Jag känner mig så ointresserad av historia, samhällskunskap eller geografi. Jag är väldigt mycket för allt eller inget, och nu är det verkligen inget i skolväg. 

Men ångesten är så blandad. Jag verkligen krigar med mina tankar. Det finns en positiv och en negativ sida som skriker på varandra hela hela tiden. Jag vill inte att den negativa sidan ska vinna och jag verkligen försöker försöker, boosta mig själv och trigga upp den positiva sidan av mig till att vinna över alla negativa tankarna som försöker få ner mig i skiten. Det är en kamp hela tiden. Som antingen slutar med att jag ligger i sängen och skakar under täcket eller faktiskt klarar av att släcka lampan och somna tryggt. Jag vet inte alla gånger hur jag ska hantera de här känslorna, hur jag ska tänka för att undvika att sättas dit. Det är jag själv som skapar dessa tankar men ändå känns det inte som att det är jag. Det är som att det är två olika jag, två helt olika sidor av mig. Varför skadar jag mig själv? Varför hittar jag på alla dessa negativa tankar när jag så gärna vill må bra? Varför gör jag det? Jag vill bara att det ska sluta men jag vet inte hur.

Har ett möte imorgon som förhoppningsvis kommer börja hjälpa mig att hamna på ett bättre spår, hjälpa mig att i fortsättningen kunna hantera sånna här situationer, jag behöver verkligen det. Det enda jag vill är ju att må bra! 

Jag är som dag/natt på dagen respektive kvällen. Det är så läskigt. 

Ska gå ner och kolla på en film nu, kärlek på menyn heter den. Måste ha någonting att göra ikväll så jag verkligen får någonting som gör att jag slipper tänka.

YOUNG WILD GIRLS


Har lagt upp det här receptet tidigare, så kika bara ner i arkivet om ni är sugna på att pröva :) 
Det är pangasus fisk med spenat + sallad. Super gott och välförtjänt! 

NU KAN INGET STOPPA MIG


Vet inte vad, om det var craze, men herregud vad jag hade energi idag. Ni vet en sån där energi som man verkligen inte känner av ofta. Men först var jag så brutalt taggad på att verkligen kötta sönder och sedan tog jag min preworkout så det är kanske inte så konstigt att det gick så bra! ;)

Efter lite väntande (gymmet var fullsmockat) så ställde jag mig på crosstrainern och stod kvar där i 25 minuter. Pressade upp pulsen till 188 som max vilket är väldigt mycket för att vara mig, maxade verkligen kändes det som. Nästa steg var att försöka få tag i ett löpband och när jag väl lyckades med det så körde jag brutala intervaller i 30 minuter. Gardient: 6.0 % (lutning), varvade vila 1,5 min (6.3 km/h) med intervaller i 1,5 min (10.5 km/h) x9. Trodde jag skulle spy efter. Tillsist tog jag mig an 30 minuter styrka på matta. Mycket mage och ben!  Och slutligen en efterlängtad stretching i en kvart. 

Känner ni er nöjda med er vecka? Efter det här träningspasset så känner jag mig mer än nöjd. Kan inte vänta tills imorgon då jag förhoppningsvis orkar öka lite på vikterna! Nu är jag helt fullkomligt död verkligen, ser typ i syner, haha, men så underbart ändå.


Svårt att stå upp, uppsvullna fingrar som skakade som asplöv

Hur efterlängtad var inte min shake då? 

PREWORKOUT:


Såja, nu är jag redo! Ska precis gå ifrån jobbet och åka till gymmet. Har en sån underbar känsla av att det här passet kommer bli ultimalt, givande och fruktansvärt jobbigt!

- TORSKSALLAD -

Senaste gången jag gjorde den här salladen blev den så himla god så jag passade på att göra den idag! 
Man steker bara upp så mycket torsk (annan fisk går självklart också bra) man vill ha, rör ihop en sallad och sedan är det klart. Jag har lite dressing och örtsalt på för att krydda det lite extra. Så gott!

Q/A

Postat av :Johanna

Hej igen, 
Dessa LCHF-bröd du tipsade om, finns de i frysdisken eller brödhyllan. Har endast letat i en butik och där fanns de ingenstans tyvärr. Sedan när du ändå pratar om ost undrar jag om du vet ifall prästost är onyttigt att äta på mackan eller till tacos eller vad som helst? :) Kram och tack för all hjälp!

Svar: När jag köpte brödet fanns det i brödhyllan, jag köpte det på ica maxi om jag minns rätt! Nej, kör. Någon skiva hit och dit är bara bra! Hoppas du hittar brödet!


Hej igen, förlåt om jag tjatar.. Kom på att jag glömde fråga ifall du vet vad som är "bra" när det gäller kolhydratsmängd i olika livsmedel? T.ex. tipsade du om ett bröd med 40 % kolhydrater, är det då 40 gram kolhydrater per 100 g man går efter då? Och hur många gram bör det max vara ifall jag vill hålla en nyttig och bra nivå? Hoppas du har tid att svara för dessa frågor och även mina förra jag skrev häromdagen! Kramar


Svar: Precis! Alltså kolhydrater är inte farligt sålänge man äter nyttiga kolhydrater i en lagom mängd. Det är när du äter för mycket kolhydrater än vad kroppen har tid att bryta ner som du går upp i vikt! Det finns ingen "max gräns". Det viktiga är att du isåfall, om du är mån om att äta kolhydrater på en bra nivå har koll på hur många gram kolhydrater du får i dig varje dag. Jag äter tex. max 100 g kolhydrater per dag! (frukost & mellis blir tillsammans ungefär 60 g kolhydrater) 


söndag - 20 januari 2013


Känns ju bra med söndag! Jag har planerat in massor av rolig träning idag. Men först ska jag till jobbet och få lite gjort! Tänkte åka till gymmet runt 3 tiden så jag har gått om tiden att spendera där innan jag måste hem och äta middag/plugga. Nästa söndag börjar jag med styrkegympan igen från 18.30-20.00 så det här är sista söndagen innan sommaren som inte är "vanlig". Dvs. idag kan jag lägga upp träningspasset hur jag vill! 

Fiberhavregrynsgröt, keso och hallon till frukost idag! (som vanligt nu för tiden) 


SPEGEL SPEGEL PÅ VÄGGEN DÄR


FÖDELSEDAGSMIDDAG


Emma bjöd på jätte god middag: marinerade kycklingsspett med sallad!


Det blev en riktigt mysig kväll!


ON THE TRAIN

Har varit en lång jobbdag och jag är SÅ glad att den är över! Nu sitter jag på tåget påväg till Emma för tjejmiddag! Tåget krånglar så vi står helt still. Kul!

Nu börjar mina ben bli bättre så jag hoppas att träningsvärken i princip försvinner helt tills imorgon. Är otroligt taggad på att köra massa kondition imorgon. Både crosstrainer och löp intervaller!


JAG STÖDJER INTE MCDONALDS MAT

Fyfan vilken rutten rubrik. Hej jag är här för att göra reklam för att jag är väldigt duktig som inte äter donken. Eller? Hatar besservissel människor (säger man så?) och så är jag en själv. HOHO. Vad är det för fel på mig. Skrattar ju till och med för att jag tycker jag är rolig. Är jag verkligen det? Eller inbillar jag mig? NEJ tillbaka till det jag skulle skriva. Nu sitter jag förhoppningsvis och äter min lunchlåda i omklädningsrummet på mcdonalds. Om mina kära arbetskollegor gett mig rast förstås, men vet ju aldrig med dem. Sist ljög jag och sa att jag behövde gå på toa, sprang då iväg och slängde i mig maten på knappt en minut, och låtsades som jag faktiskt gått på toa. Sneaky. Men vad ska gör man inte för att få ihop mat och jobb med träning och mat med träning och jobb med allt som gaaaaaaah får panik. Tjohoj sålänge! 

uppladdning på energi innan jobb

Det är -18 grader ute och det säger väl det mesta till att jag inte är så jätte taggat på att åka in till jobbet idag. Känns förjävligt! Men jobb är jobb. Blir en rolig kväll iallafall så då har jag någonting att se framemot!

GGAV MIG UT I KYLAN

Tog saken i egna händer och gick ut i -14 grader. Har myst hos Ebba hela kvällen. Snart kommer pappa och hämtar mig och Jenny, time to sleep. Ska upp halv 9 imorgon! Jobbet väntar och sedan tjejmiddag hos Emma! Skönt att jag redan packat alla kläder och mat!


FEM LAXAR I EN LAX ASK



Har ni hört den förut eller? Min pappa brukade alltid säga förut när jag var liten att om jag kunde säga fem laxar i en lax ask 10 gånger super fort så skulle jag få en miljon. Jag lyckades aldrig. Pröva själva.. 

När man har brist på fantasti och är vrålhungrig är det lätt att bara steka upp lax och göra en förträffligt (älskar det suveräna ordet) (suveränt är ju bara så suveränt) god sallad. Har tänkt på en sak. Mat kostar så sjukt mycket pengar. I det här hushållet iallafall. Jag antar att jag är rätt dyr i drift, hehehehehehe. Fast ändå inte. 

Men jag har tänkt på en sak. Det skulle vara kul och veta vilka ni är som läser det här inlägget nu till exempel. Jag pratar ju bara om mig själv hela tiden (okej det är min blogg så det är väl meningen men ändå) och det skulle vara så kul och veta lite om er. Hur gamla är ni och varför läser ni den här bloggen? Puss på er!

KRAV PÅ OSS SJÄLVA

Jag vet inte hur ni känner men åtmistone jag ställer otroligt höga krav på mig själv. När jag ger mig in i någonting till 110 %, som i träningsväg så nöjer jag mig sällan med mina prestationer. Låt mig ta ett exempel.

Mamma har åkt längdåkningsskidor idag och sen dess har hon gått runt i huset och upprepat tusen gånger hur nöjd hon är med sig själv. Min första tanke är: tänk om jag kunde vara så stolt över mig själv när jag tagit mig igenom ett krävande konditionspass? Tänk om jag kunde vara så nöjd med mig själv? Det är alltid något fel. Jag har en tendens till att överanalysera allt, tänka på allt i minsta detalj och intala mig själv att jag kunde presterat bättre och gjort ännu bättre. Att jag faktiskt hade kunnat om jag ansträngt mig lite till. Faktiskt. Det här resulterar i att jag blir besviken på mig själv och aldrig nöjer mig med vad jag gör. Antingen tränar jag för länge eller för kort. Antingen är pulsen för hög eller låg. Antingen tränar jag för mycket styrka eller för mycket kondition. Antingen över tränar jag eller så tränar jag för lite. Antingen äter jag för mycket eller så äter jag för lite. Antingen eller. Mamma tränar inte överdrivet mycket, sisådär 2-3 gånger i veckan kanske, normalt. Men hon uppskattar sig själv när hon tränat och ger sig själv cred. 
 
Jag däremot, jag har vant mig vid att träna såhär mycket som jag gör och äta på detta vis så jag imponeras inte av det längre. Jag ser det som en självklarthet för mig, det är saker jag bara gör, utan att tänka på det, skulle jag inte göra det skulle mitt system förstöras totalt. Allt handlar om planering. Det blir därför lätt att jag ställer för höga krav på mig själv, jag vänjer mig, blir blind för styrkeviljan jag egentligen har, för när jag klarat av något svårt vill jag sedan alltid ha mer. Jag blir aldrig nöjd. Jag beundras av andra i min närhet som lever en liknande livsstil som jag men jag kan ändå inte, trots detta, bli stolt över mig själv. Hur ska jag kunna förklara hur svårt det är. Jag kan inte se det andra ser hos mig. Poängen är den att när jag började träna gjorde jag framsteg, jag gick över en tröskel som jag inte trodde jag kunde kliva över, det gjorde att jag blev stolt. Jag kunde faktiskt då vara stolt över mig själv och jag blev glad, jag blev gladare än jag var förut. Jag började tro mer på mig själv. Nu däremot när jag har klivit över den tröskeln för länge sedan och förändrat mitt liv har jag slutat beundrats av mig själv, jag har slutat ge mig själv feedback för alla tidiga mornar, för att jag aldrig fuskar med maten, för att jag är så noga med sömnen eller varför inte: för att jag inte ger upp. Varför? Svaret är enkelt. Jag har vant mig. Jag är min absolut största fiende och det jag kräver av mig själv kräver inte någon annan av mig. 

En betydelsefull person sa en gång till mig "det är dags att skaffa dig lite perspektiv nu, se dig runt. Ser du inte? Hur kan du inte se?". Det finns dagar då jag ser mig själv i spegeln och är stolt, det finns det, vissa dagar, bra dagar. Det tråkiga är att dem försvinner lika fort som dem kommer. 

Jag vet fortfarande inte hur ni känner, om ni känner igen er eller inte. Om ni förstår något av hur jag resonerar eller om ni överhuvudtaget funderar i de här banorna någon gång. Men det jag vet är att det här inte är sunt. Självklart måste man ställa krav på sig själv för att kunna åstakomma något här i livet. Man kan inte bara ligga i sängen hela livet och äta bullar (självklart kan man men..) och tro att resten kommer komma på en räkmacka. Men, (alla dessa men) för att kunna bli nöjd måste vi lära oss att uppskatta allt vi gör och på samma gång inget vi gör. Alla dessa valmöjligheter vi har idag gör det svårare för oss. Vi tror att livet blir bättre när vi har ett större utbud av varor och tjänster men i själva verket blir livet bara svårare. Det orsakar för många det läskiga ordet: depression. Vi blir osäkra, inbillar oss att vi kunde gjort eller valt bättre. Att vi gjorde fel val och att vi hade kunnat bli lite bättre om vi gjort ett annat val. Det finns en gräns, en hårfin gräns till ett specifikt antal valmöjligheter som kan göra oss gott, men den gränsen har vi passerat för länge sedan. Vi människor.

Jag ska lära mig att uppskatta allt jag gör och inget jag gör. Jag ska lära mig att bli nöjd, nöja mig med det som är. Jag ska inte försöka sträva efter perfektion. Har man för höga krav bli man bara besviken, och allt slutar i en negativ spiral som bara fortsätter och fortsätter, och tro mig den slutar aldrig.


Bilden togs i början av förra året

Q/A

hur är det här med att äta ost? nyttigt, eller onyttigt? jag älskar ost och kan äta hur mkt som helst, men är rädd aatt det påverkar min vikt. vad vet du om det?
 
Svar: Ost innehåller väldigt mycket fett (många kalorier), äter du hur mycket ost som helst, ja du kommer gå upp i vikt, om du inte gör dig av med det du ätit genom att förbränna det. Allt i moderation är bra, okej inte allt men det mesta. Fett måste vi få i oss, det behöver kroppen, men det innebär inte att man ska överdriva heller. Det är inte nyttigt att komma hem och äta 50 ostskivor och tro att det är nyttigt, det är det inte. Det är heller inte nyttigt att äta zero. Men, det finns olika ostar och näringsinnehållet varierar väldigt mycket. Vissa ostar är fetare och saltare än andra, och dem bör du akta dig lite mer för. Men en ost skiva någon gång om dagen kommer inte skada, det finns magra alternativ. Permesan och chevre är bra! 

Kan man köra konditionsträning i 30 minuter mer eller mindre och sedan köra ett styrkepass efteråt? Och tvärtom att man kör styrka först o avslutar med kondition? Jag hört/läst att det inte tar lika mycket om man blandar kondition och styrka.. Men vet inte om det är sant.. Vet du? Kraaam!

Svar: Att köra ett hårt benpass (så att du verkligen maxar och skakar efteråt) och sedan köra hård konditionsträning efter ska du inte göra. Du kommer inte se några bra resultat. När jag tränar styrketräning före/efter kondition så tränar jag aldrig samma muskelgrupp. På måndagar kör jag tex. bröst, biceps och mage, efter det spinning. Har då inte belastat benen utan överkroppen. Skulle ge en negativ effekt om jag körde hårt benpass och sedan gav mig på intensiv cykling i 30 minuter. AJJ. INTE BRA. Men så länge du låter muskelgruppen du använt vila (återhämta sig) så ser jag inget fel i att blanda kondition och styrka på en dag. Efter ett benpass bör du vila från att anstränga benen i 2-3 dagar för att dem ska kunna återhämta sig igen. Men då snackar vi jag-kan-inte-röra-mig smärtan. Ger du dig på benen med träningsvärk så kommer du inte bli 100%, du kommer inte kunna maxa för kroppen får inte tid att återhämta sig. Det är därför vila är så viktig. Muskelfibrerna bara slits ut och slits ut om du inte lyssnar på kroppen!

LUNCH DAGS:

Kyckling och sallad efter träning!


MORGON TRÄNING

Skönt med lite lugn och ro på gymmet! På håltimmen körde jag baksida axlar, rygg och triceps! Gick rätt bra faktiskt, hade inte mer än drygt en timme på mig men jag lyckades ändå hinna med allt hyffsat. Längtar till söndag då mina ben förhoppningsvis tillåter konditionsträning! Jag är fortfarande helt handikappad, knappt kunnat sova någonting i natt. Men jag ska inte klaga!


Hello engelska lektion

Ibland kanske man pratar om "happy pain" men jag kan säga att jag känner ingen sådan, alls. Det här är bara fruktansvärt. Jag kan inte sova, sätta mig ner, gå på toa, gå normalt eller i princip göra någonting. Jag har verkligen så ont och jag överdriver inte.

Men nu sitter jag i skolan efter massa om och men, räknar ner till gymmet. Bara 1,5 timme kvar nu! :D


Kvällens coaching av Andreas

Ledde till att det inte blir något spinningpass imorgon bitti. 
Blir typ arg när jag tänker på det, eftersom jag vill köra sista cyklingen för den här veckan men morgoncyklingen kommer aldrig bli av framöver. Åtminstone inte när jag har ett benpass på onsdagen. Han försökte förklara för mig hur det ligger till. Mina muskelfibrer håller på att reparera sig just nu, förfullt. Dem är helt utslitna efter benpasset igår, därav träningsvärken som är så brutal att jag har svårt att röra mig. Skulle jag sätta mig på cykelsadeln imorgon bitti med stort motstånd och köra gärnet, då skulle det vara som att riva upp ett halvöppet sår. Ett sår som nästan är läkt, men så river jag upp det ännu mer genom att inte låta det läka fullt ut. Det ger bara en negativ effekt, inte någon positiv. Han har förklarat för mig att efter ett benpass så måste jag vila i två dagar från att anstänga benen. Det är då jag kommer se resultat.

Så: inget spinningpass imorgon inte. På håltimmen blir det styrka på överkroppen som redan var planerat. Kommer nog ta ett tag att köra igenom det passet, men får köra färre antal set om jag ska hinna från 10.30-12.30.   Ska äta stor frukost imorgon också. Andreas får det att låta så lätt. "Ja, men eftersom du äter frukost 07.00 och inte äter innan kl. 12 så ät gröt och två ägg till frukost". Känns som jag kommer bli smällfet, och det är ju inte mitt mål. Men får bara lita på hans ord, han vet nog vad han pratar om. 

Nu ska jag sova och ladda för imorgon, hela träningsväskan är packad och maten är klar! 

Ursäkta för ett rörigt inlägg! Det blev fel i mitt system ikväll, mina planer om gårdagen förstördes så nu måste jag bearbeta detta ett tag. Haha. Känner mig galen. Men nu kommer jag inte träna cardio på två dagar, och det känns skit dåligt. Känner mig usel. (Måste verkligen jobba på den här biten, att lyssna på kroppen och våga äta lite mer) 

ÖVERTALAR PATRICIA ATT CYKLA



Dagens middag:

Mamma lagade en jätte god kyckling ikväll! Den stod i ugnen i två timmar men blev äntligen klar vid åtta.
God sallad till också, standard hehe! 

Q/A

Jag ger upp det där med att svara på era frågor varje söndag, svarar när jag har tid istället, och nu råkar jag ha tid hela dagen/kvällen eftersom jag varit ledig från skolan idag och redan tränat! 

Postat av: Tina

Gud vad trist!Svårt att börja igen när man har slutat.Men jag har en fråga. Under spinningpassen: förväntas det att man ska ta i mellan de olika intervallen? Eller hur jobbigt ska det vara där?Jag, som innerst inne är lat, ger mig i princip total villa mellan men då blir ju självaste passet inte så jobbigt? Hmm...

Svar: Tänk såhär, det ska vara så jobbigt under intervallerna så att du i princip måste ha total vila mellan intervallerna för att orka ;) Nej men helt seriöst nu: du måste lyssna på din kropp, vad den säger åt dig, vad den orkar, det är det viktigaste. Som jag förstår av vad du berättar så orkar din kropp men det är du som gärna vill vara lite bekväm? :) Om du skulle orka köra hyffsat jobbigt under vilan (mellan låtarna, intervallerna) på passet så  kör du inte tillräckligt hårt under självaste intervallerna (som ska vara ett jobbigt helvete). Det du då måste göra är att öka motståndet/hastigheten när det väl gäller och sedan när du har några sekunder för vila, då vila, se till att andningen fungerar som den ska igen. Förstår du hur jag menar? Våga utmana dig själv! Om du säger att passet inte blir så jobbigt om du vilar mellan intervallerna så vila inte! Haha! Då gör du fel och måste öka motståndet/tempot, inte ge dig total vila mellan. 

Det förväntas inget av dig under spinningpassen, spinning är en väldigt individuell träning trots att det är gruppträning. Du ska utgå från dig själv, vad du har kapacitet till att klara av. Jag sätter upp mina egna förväntningar på mig själv under passet, sedan får jag hjälp av instruktören att nå dem! Om jag har bestämt mig för att jag vill nå 180 i puls innan passet är slut, ja då pushar instruktören mig till att nå det målet! :) Det finns absolut plats för vila under passet, men alla cykelpass är upplagda på olika sätt. På 55 minuters pass brukar du ha en längre vila halvvägs, på 30 minuterspass är det rakt på och 45 minuter brukar det vara en vila på 1-2 minuter halvvägs. Det är då du verkligen verkligen ska vila. Hoppas du förstår på ett ungefär :) 


2 januari - 17 januari

Nu är det drygt två veckor sedan nyår, dvs. två veckor sedan jag startade om men strikt kost. En av de veckorna var jag sjuk så det är nu den här veckan jag verkligen kunnat träna fullt ut. Hur jag det gått då? Maten har rullat på som vanligt, inga större problem. Inget sockersug. När jag omringar mig av nyttig mat så är det ingen utmaning att hålla sig borta, jag vet att min kropp mår bäst av nyttig mat. Träningen då? Har bara gått 4 dagar och jag kan inte gå, sätta mig ner, eller knappt röra mig. Tränar nya muskelgrupper med nya övningar vilket ger en träningsvärk jag aldrig varit med om förut. Men jag tycker ändå det flyter på bra och jag kämpar på, alla timmar på gymmet kommer löna sig. Mitt i all svett så njuter jag ändå längst inne :) Styrketräningen kommer gå bättre när jag verkligen får reda på alla övningar och tips som Andreas gett mig. Känner mig fortfarande lite osäker när jag står bland alla biffarna men jag vänjer mig nog! 

Nu gäller det att ha tålamod! 
 

Q/A

Postat av: Klara

Har du slutat med ridning? Du skriver aldrig om det längre.

Svar: Efter cirka 10 år som jag ridit så har jag slutat nu. Sa upp mig förra veckan och jag har fyra lektioner kvar nu. Har inte kunnat gå på några veckor av olika anledningar. Nästa onsdag har jag nationella i engelska tex. så då kommer jag inte heller kunna gå. Men näst nästa vecka är det sista gånger som jag rider! 

 
Postat av: Emilia

Va fick dig att just börja med ''dieten'' att du inte skulle äta kolhydrater? Om man är idrottare är ju kolhydrater ändå viktigt att få i sig! :)

Svar: Av den enkla anledningen att jag ville gå ner i vikt och slutar man med kolhydrater (så som pasta, ris, potatis, bröd) så lägger man inte på sig massa onödig vätska som kolhydraterna binder. Jag har mått väldigt bra av att köra LCHF också, magen fungerar precis som den ska och, det funkar toppen för mig. Ser ingen anledning att äta kolhydrater bara för att. Men nu har jag börjat äta gröt till frukost och 50 g ris innan träning men det är den mängden kolhydrater jag får i mig dagligen. Har ändrat mitt träningsschema och därav strukturerat om lite i kostschemat! ;) Det där med att man måste ha i sig kolhydrater orkar jag inte riktigt bry mig om. Så länge jag mår bra av det jag äter, vilket jag gör, min mage är känslig för kolhydrater, så är jag nöjd. Det handlar inte om någon extrem diet, jag byter ut kolisarna mot sallad istället. Långsammare kolhydrater ibland!


SMAKLÖKARNA VET BÄST

Sen jag åt gammal tonfisk en gång (minns fortfarande smaken) så kan jag verkligen inte få i mig tonfisk. Blir så äcklad. Men det kunde jag ju inte tänkt på innan jag packade ner matlådan och åkte till gymmet, nejdå. Så nu sitter jag här och får verkligen inte i mig mer, mår bara illa. Tur att jag ska äta mellis vid fem..


DÖD

Finns inget bättre ord som kan beskriva hur jag känner mig just nu ;) Gritcardio passet verkligen mördade mig! Så underbaaaart. 30 minuters superintensiv konditionsträning! Därefter dödade jag mina axlar i 1 1/2 timme. Nyduschad och klar nu, snart kommer mammsen och hämtar mig!


NU FINNS DET INGEN ÅTERVÄNDO

Har smällt i mig en god frukost och är nu påväg mot gymmet! Gritcardio och axlar står på schemat, frktar verkligen gritcardio för det är så förbannat jobbigt. Men jag och min träningsvärk ska klara det! (kan inte ens sätta mig på toalettstolen utan att skrika). Önska mig lycka till!


Att tänka och sedan tänka lite till

Det är jag väldigt bra på. Igår fick jag sjukt mycket ångest, kände det i hela kroppen men jag kunde inte avgöra varför jag kände som jag kände. Men nu har jag kommit fram till vad det var. Jag har insett hur jobbiga de kommande veckorna/2-3 månaderna kommer bli! Efter ett antal träningspass har jag fått smaka på den medicinen kan jag säga! Jag tänkte från början, vad skönt att köra lite mer styrka, för kondition är ju verkligen piss jobbigt, men nu när jag kört min styrka i snart en vecka så ångrar jag mig. Haha! Vaknade i natt för att jag inte kunde röra mig, kunde inte vända mig om i sängen för att jag har så mycket träningsvärk. Benen, rumpan, nacken, you name it! Det är skönt att veta att det tar iallafall och att jag kommer se skillnad! 

Ångesten får jag leva med. Jag vet att jag kommer klara av det här och jag blir starkare efter varje pass! Det tar så sjukt lång tid att köra styrka, för mig kan ett ben pass ta (som igår) över 2 timmar. Och då körde jag cirka 7-8 set på allting, så det är ändå mycket, men det är ju då det tar som bäst. Och jag vill ha bäst resultat! 

Jag ska klara det här :D

TONIGHT: THIS IS HOW I FEEL




RECEPT - OMELETT


1. Fräs upp en gul lök och 2 vitlöksklyftor tillsammans med en tesked kokosolja
2. Häll sedan i 1/2 rödpeppar och krydda med fisksås (fungerar som salt, använder fisksås i allt)  
3. Skär sedan upp så mycket skinka du vill ha i omeletten och häll sedan i den i stekpannan.
4. Vispa 6 ägg med 1 dl matlagningsgrädde och häll ner i stekpannan.

Viktigt att tänka på: Stek på svag värme och vänd omeletten med en tallrik!

Remember: muscles are teared in the gym, fed in the kitchen and built in bed

Här har ni ett bevis på att de som säger att det är svårt och krångligt att laga/äta nyttig mat har fel. Det är bara en ursäkt till att äta onyttigt. Det här slängde jag ihop på 15 minuter. Såhär gör du:

1. Sätter på stekpannan, när den är varm häller du på en klick kokosolja 
2. Tar köttfärs från kylen och formar köttfärsen till två hamburgare. (relativt smala eftersom dem blir mindre)
3. Lägger i dem i stekpannan på låg värme för att minska risken för att bränna dem.
4. Saltar och pepprar.
5. Valfritt tillbehör, jag som inte äter kolhydrater tog givetvis sallad. 
6. Klart!

Svårare än så är det inte! Och om det var gott :) 

Känslan efter över två timmar på gymmet

Känns lite konstig. Man börjar när det är ljust ute och när man är klar är det kolsvart. Nu vill jag verkligen ha vår! Blev iallafall ett styrkepass fyllt med ben, vader och mage. Raka marklyft, benböj med vikter, benpress (enbens), situps, vadpress, baksida lår liggandes i maskin osv. Skakar nästan fortfarande. Som uppvärmning rodde jag i 10 minuter och som nedvarvning gick jag på löpbandet i 20 minuter lugnt. Benen höll på att ge vika så jag fick ta det lite lugnt i slutet. Det sköna var att mamma var i centrum när jag precis var klar så jag fick skjuts hem av henne också :) 

Nu är jag glad igen. Historia provet är gjort och jag har z-dag imorgon! 

LÅNGA NÄTTER


Har legat och drömt om gymmet i natt, om de där vikterna jag ska lyfta i smithmaskinen. Drömde att jag tappade alla på mig själv och på alla andra, dvs. jag förstörde allt. Hehe. Hoppas det går bättre idag än det gjorde i drömmen. Annars, jag har inte sovit så mycket inatt. Varför? Jag är orolig för någonting jag inte riktigt kan sätta fingret på, om det är för den där maskinen, provet i eftermiddag eller något annat kan jag inte bestämma mig för. Någon blandning skulle jag tro. 

Efter att ha ätit en jätte god frukost (ägg-fiberhavregrynsgröt med keso, kanel och hallon) så ska jag packa det sista och sedan gå ut för att utmana ödet (i detta kalla hemska väder). Borde verkligen sätta på mig ett underställ men jag orkar verkligen ta av mig byxorna, hehe... Vi hörs sen istället!

Q/A

Postat av: Julia

Hur var det att träna själv? Jag skulle gärna vilja börja på gym, men jag är inte så peppad på att gå själv :/

Svar: Jag förstår vad du menar! Men jag tycker ändå inte det är en anledning till att inte köpa gymkort! ;)
Att träna själv tycker jag är bäst. Åtmistone jag är mer koncentrerad, intensiv och inne i min egen värld. Självklart är det ibland roligt att träna med en kompis, för omväxlingens skull, om man kanske kör ett långt styrkepass eller liknande, men annars tycker jag att det ger mest att träna själv. Jag tycker absolut inte du ska avstå från gymmet bara för att du inte har någon där med dig. Peppa dina kompisar att köpa att börja med dig? Men jag kan verkligen säga att, träna själv är inte så tråkigt som det låter! Men det blir vad man gör det till helt enkelt :) 


- No diet can do what eating healthy does -

Mamma gör de godaste omeletterna i universum! En sådan blev det idag med sallad till. Om ni vill kan jag dela med mig receptet? Kommentera isåfall!

Nu: svenska hollywood fruar (hatar dem så mycket att jag älskar dem)


15 Januari 2013

Just nu känns det som att det inte finns någonting jag inte kan göra (ursäkta min självgodhet, jag menar inget illa), hehe ni förstår vad jag menar. Känner mig så stark! Efter cyklingen och core (smet in på den trots att jag inte hade anmält mig hehe) så kom mamma och hämtade mig. Skönt att slippa gå hem i det här snökaoset! Var en riktig utmaning på satscore idag, har inte gått på det på länge och man märker verkligen av det, att man inte varit där alltså. Härligt!



Invigde min nya mössa idag. Den är från soc och är verkligen att rekommendera!


Jag är redo!


Mellis - dags att fylla på med energi

Sådärja! 50 g råris, 3 skivor kalkon och en klick keso.


Snökaoset är här igen - för att stanna

Skadeglädjen är enorm när alla vännerna slutar fyra idag förutom jag, jag slutar som slutade klockan två. Innan jag beger mig till det efterlängtade gymmet väntar lite historia-plugg, ska skriva lite fusklappar till provet imorgon ;)

Jag är fortfarande lika lycklig som jag var igår, den här dagen har varit lika bra som gårdagen! Och kan den avslutas bättre än med ett cykel&core pass? Skulle inte tro det!


Q/A

Postat av: Julia

När du började träna på gym, gick du ensam på pass då eller hade du någon kompis med dig?

Svar: Jag tränade alltid ensam!


FRUKOSTDAGS:

Sa någon frukost? Fy satan vad god frukost jag åt precis! 1 dl fiberhavregryn blandat med 1 tsk kakao toppat med keso och hallon. (För er som inte visste det så är kakao jätte nyttigt, det är när det blandas med socker och diverse som det blir onyttigt). Smakade riktigt gott!


MIN RESA

Och så var det den 6:e Mars 2012, jag satt med godispåsen och min egna ben&jerry framför tv:n i sälen och spelade kort med syrran. Jag satt där och njöt av min sista godispåse, min sista ben&jerry på väldigt länge, jag hade bestämt mig, redan då, redan den 6:e Mars. Jag visste att det inte var min sista chans, jag var bara 16 år, dock visste jag gott och väl att det var den chansen allt hängde på, den sista chansen för mig att någonsin tro att jag kunde förändras. Om jag sabbade det den här gången hade jag tappat hoppat om mig själv överhuvudtaget. Tron på min styrkevilja, tron på mig själv och tron på vad jag överhuvudtaget kunde göra. Efter en vecka i Sälen med regelbundet onyttigt ätande dag/kväll/natt kom jag hem till Stockholm. När jag köpte gymkort 14:e Mars bestämde jag mig för att inga före-bilder skulle tas. Jag var för osäker på om jag skulle klara av resan jag stod inför, om jag skulle ge upp eller om jag skulle klara av att bita i det sura äpplet och fortsätta kämpa. Rädslan, tviveln på vad jag klarade av gjorde därför att jag struntade i de förbannade bilderna. Tänk om jag hade hoppat av mitt i allt och stått där med före-bilderna ett halvår senare och sett likadan ut? Hade inte ångesten varit ännu värre då? 

Vecka efter vecka gick och jag började se mig själv igen, se mig själv på mer rättvist sätt. Jag märkte att det inte längre handlade om att gå ner i vikt, få mindre dubbelhaka eller komma i gamla jeans. Jag började må bättre, inte bara i mig själv, jag började kunna glädjas mer åt andra, bli positivare i vardagen och orka mer. Träningen var ett jobbigt helvete och sötsuget var där ständigt, trots att jag många stunder försökte förneka det, men det var någonting som gjorde att jag ändå satte mig på cykelsadeln varje tisdag trots vetskapen om vilken jobbig timme det skulle bli. Det där "någonting" blev som en drog, jag behövde det för att fungera, för att må bra. Jag mådde så bra av träningen, att gå till gymmet var nu så kul och jag nöjt av varenda sekund.

Väl i USA över sommaren ställde jag mig på löpbandet varje morgon och därmed märkte jag att jag klarade av mer än jag någonsin trott om mig själv. Jag hade antagit utmaningen och inte gett upp, inte en enda sekund. Jag insåg nu att jag hade den styrkan som inte många hade, viljan att förändras till det bättre trots att det än inte var många som visste om min livsförändring eller något i den stilen. Jag klarade det själv. Utan vidare stöd hemifrån eller från omgivningen. Jag lärde mig att det jag stoppade i mig också behövde förbrännas, för mitt eget bästa. 

Väl hemma från USA tog jag saken i egna händer och fortsatte med träningen, nu ännu hårdare än någonsin. Höjde mina krav på mig själv markant, däribland en mer träningsdag i veckan, striktare kost, striktare rutiner, tidigare mornar och matlåda till skolan varje dag. Allt som störde mina rutiner uteslöt jag. Om det så var släktmiddagar, tjejkvällar, bruncher, sovmornar eller skolan uteslöt jag. Ibland skolkade jag från lektionerna efter lunch för att hinna träna, andra dagar tog jag sovmorgon för att slippa gå hungrig från 8.20-11.25, tills lunchen började. För att istället äta min frukost klockan 9, allt för att inte behöva öka intaget av mat. Sakta men säkert var jag nervös inför varje cykelpass, nervös för att jag inte skulle prestera till max. Ångestattacker pågick då jag vissa stunder fick panik på grund av pressen på mig själv. Oron om att äta för mycket började också växa inom mig. Aldrig slutade jag äta, men synen på vad mat gjorde med mig blev allt sämre. Jag såg inte längre mat som något min kropp behövde, ju mindre jag åt desto bättre, jag kunde kontrollera mig mer och det var exakt vad allt handlade om, kontrollen. Mitt i detta var träningen inte längre rolig, jag mådde inte bra av den på samma sätt som innan sommaren, den blev värre trots att jag var många kilo lättare och dubbelhakan betydligt mindre. Jag såg inte mina framsteg, jag såg inte allt jag åstakommit, jag såg inte styrkan jag hade haft, jag såg bara allt negativt, allt jag ännu inte hade åstakommit och de mål jag ännu inte hade nått. Mina krav på mig själv gjorde att jag blev blind, jag såg inte själv hur mycket jag kämpade, jag trodde alltid sämre om mig själv, att jag inte kämpade tillräckligt hårt. Trots att jag gick skakis från cykelpassen varje gång. Jag minns när började jag till grät efter ett cykelpass för att bägaren rann över, psyket orkade inte mer, mina krav på mig själv blev ouppnåliga. Mitt i allt detta tvingades jag inse att jag hade gått till en överdrift, att det jag hade trott var hälsosamt nu var ohälsosamt. Jag fick höra det från alla håll och hörn, du kan inte träna så mycket, du äter för nyttigt, du överdriver, du gör det och det. När jag fick någon positiv feedback omvandlades det ändå fort till något negativt. När jag nådde punkten då jag insåg att hela min hjärna var mindfuckad såg jag också detta som ett misslyckande. Jag hade misslyckats med mitt mål. Vem vill liksom erkänna för sig själv att man är ett freak som inte kan bibehålla kontrollen? Att jag även denna gång hade haft fel.

Att inse detta var något av det svåraste jag gick igenom förra året. Många sömnlösa nätter. Många panikattacker med brist på att ingen förstod. Jag begärde inte att någon skulle förstå för vem skulle förstå ett freak, som mig. Det inrutade schemat förändrade mig. Att inte kunna gå en dag utan att träna, jag hade ju aldrig gjort något annat. En gång fick jag frågan, "får du ångest om du hoppar över en träning?" det självklara svaret var då: "det har aldrig hänt, så jag vet faktiskt inte". Det tog lång tid innan jag berättade något om mitt problem, det jag först behövde erkänna för mig själv, att jag, som älskar mat, faktiskt hade. Att det hade drabbat mig, när hände det liksom? Helt plötsligt stod jag där och kontrollerade näringsinnehållet på varje råvara innan jag stoppade ner det i magen. Läste artiklar om träning och hälsa minst två timmar varje dag, för att vara säker på att jag tränade och åt rätt, eftersom oron om att inte se rätt resultat ständigt tog över. Där försökte jag omvandla alla osunda vanor till positiva, trots att jag visste att det var fel. Kontrollen, den var värst. Jag behövde ha kontroll på allt, för att jag skulle fungera. Det behöver jag fortfarande ha. Inget får rubba mitt schema. Min träning eller min mat. Det förstör systemet. På samma sätt som de med astberger har svårt med närkontakt. Jag stöter ifrån mig de människor i mitt liv som försöker ändra på mig, för de kan rubba min plan. Jag är bra på konsekvenser, därför kunde jag lista ut att det kunde leda till ännu ett misslyckande. 

Jag hittade på nya orsaker till maten och träningen hela tiden. Men jag blev aldrig nöjdare. Det var mitt huvud som sabbade det, sabbade möjligheten att bli nöjd med spegelbilden. Vad hade hänt? Jag hade sagt att jag vid 56 kg skulle ha nått mitt mål, men varför stod jag då där med den siffran och grät? Besviken på att jag inte såg ut som jag hade hoppats. Men när skulle jag någonsin bli nöjd? Vem skulle låta mig? 

När jag satt och grät i skolan med sats väskan i knät och paniken i halsgropen en helt vanlig dag hade jag fått nog. Jag kunde inte ta det mer. På insidan var jag helt förstörd trots att jag såg bra ut på utsidan.

En sån här livsförändring kan leda till så mycket mer än bara lycka. Det kan påverka en på så många fler sätt en bara positiva. Det kan sätta spår i hjärnan som man inte vill komma i närheten av. När jag idag hör ordet ortoroxi börjar jag gråta. Liksom tvångstankar har jag nu istället fått sådana som innefattar kontroll. "Du får inte ta lite mer sallad för du måste bevisa för dig själv att du kan ha kontroll och avstå". "Du får inte ta ett extra tuggummi." "Du får inte göra det och inte det". Det kommer ta lång tid för mig att kunna se mig själv på ett rättvist sätt igen, det jag faktiskt förtjänar. 

Jag ångrar inte att jag gick in i det här med 100 %, det är mitt bästa beslut någonsin och har bara, bara gjort mig starkare men jag råder er att, jag lovar er, lagom är bäst. Jag har nu börjat leva efter att jag vill leva som jag lär, och jag hoppas verkligen att den här texten ovan kan få er att få ökad förståelse vad som kan hända. Jag har inte hamnat i träsket, det värsta träsket, men det hade lika gärna kunnat hända om jag inte hade haft mina mestadels förstående och underbara vänner. De som fått mig att få perspektiv. På mig själv och andra. Att jag inte har samma stöd från familjen har inte påverkat mig på samma sätt, just för att jag haft mina vänner. 

Jag mår bättre nu, som tur är. Det har gått fort, allt har gått så fort men jag är på bättringsvägen. Jag har accepterat vad som hänt, fått mer perspektiv och kämpar varje dag för att bli bättre och få bort de onda tankarna i mitt huvud som ständig säger emot mig. Och för att klara det måste jag få hjälp, jag måste våga ta hjälp, våga förstå att det är starkt gjort av mig och att det inte är där svagheten ligger. Det är svårt att förklara allt som hänt med ord men det är betydligt lättare att skriva. Texten ovan beskriver den negativa sidan med den förändringen jag gjorde för snart ett år sedan. Alla påverkas vi olika av olika förändringar/situationer, men jag rekommenderar aldrig dig som är osäker i grunden att göra en såhär stor förändring så fort. Det är väldigt lätt att man hamnar på villospår utan att märka det själv, trots att man aldrig tror att det är möjligt för en själv. Som ni annars förstår brinner jag för träning och hälsa idag, det positiva överväger det negativa men det är inte lätt varje dag, det är svinigt jobbigt. Men i slutändan ändå värd all börda.
 
Jag är starkare idag.

Q/A

Hur tränade du i början? Du skriver att du körde väldigt mycket kondition, men hur många pass i veckan och om dagen? några tips? :)
 
Svar: När jag började träna i slutet av Mars bestod min träning mestadels av löpning och crosstraining. Började inte gå på pass förens slutet av April - början av Maj så då blev det också mycket styrka med maskiner. Vilket jag inte riktigt rekommenderar när man börjar träna på gym. Finns så många bättre sätt att träna på än att använda maskiner som man egentligen inte riktigt vet fungerar i början ;) Men i April började jag gå på mer pass (powerstep en gång i veckan, shape, yoga, zumba, pilates) och i slutet av Maj - början av Juni började jag med cykelpass. Jag tränade nu 5 dagar i veckan och då var det 90 % kondition. På olika sätt, ibland löpning på gym eller crosstraining, ibland cykelpass, eller andra pass där fokus var på cardio. Det blev en blandning! Detta var alltså innan sommaren, när jag började träna.

Sedan när jag kom hem från usa - i Augusti började jag träna 6 dagar i veckan och då låg fokus också på cardio/förbränningsträning. Cykling 2-3 ggr i veckan, annan konditionsträning (löpning, powerstep, gym) 1-2 ggr i veckan och styrka 1-2 ggr i veckan (söndagsgympa eller egen styrka hemma eller på gym). Så majoriteten kondition! Körde alltid ett pass om dagen, oftast inte längre än 1 timme. Bättre korta och intensiva än långa och ointensiva. En vanlig vecka kunde se ut såhär: måndag: cykling 45 minuter, pilates 55 minuter. Tisdag: Cykling 30 min, satscore 30 min. Onsdag: Ridning. Torsdag: Powerstep 55 min. Lördag: Cykling 30 min, satscore 30 min. Söndag: Styrkegympa, löpning. (Ibland bytte jag självklart ut cykling mot gym, annan kondition. 

Tips: 1. Bli aldrig bekväm i träningen, det ska vara ett jobbigt helvete. 2. Se till att lyssna på kroppen. 3. Drick mycket vatten. 4. Variera träningen, det kommer ge dig bättre resultat. 5. Var inte rädd för att lyfta. 6. Utmana dig själv. 7. Kom ihåg att varje litet framsteg är ett framsteg, ett steg närmare ditt mål! 

Dinner is served!

Laxfilé, ett kokt ägg med god sallad till. Nu börjar pluggandet för den här kvällen. Tur att det inte är mycket. Ska sätta mig och plinka på gitarren, ensamble läxa tills imorgon! Synd att jag har historia prov på onsdag som jag måste plugga till också :(( Men ska inte klaga!
Jag stekte bara laxen i stekpannan med kokosolja, och kryddor = salt och peppar
När jag kokar mina ägg använder jag mig av en äggmaskin som mäter ut exakt tid & värme för att få det perfekta ägget. Det går verkligen jätte fort så kan rekommendera en sån maskin om man inte har tid att stå och koka ägg på spisen med kastrull. Detta går på 2 minuter och du kan gå iväg osv (piper när ägget är klart). 

NOBODY PUTS BABY IN A CORNER


Rubriken får tala för sig själv. Blev klar med träningen 18.45 men som ni vet, blir lite svårt att hinna blogga när jag slutar 16.00 och sedan ska träna, kommer hem och ska äta + duscha. Ska dock försöka hinna med lite tidsinställda inlägg framöver i veckorna eftersom ungefär alla inlägg annars kommer in på kvällen vid 20.00-23.00, lite segt! Jag är iallafall överlycklig och det hoppas jag ni också är. Att era veckor börjat bra?!

Jag kan säga att den föregående veckan fylldes med välbehövlig vila, jag är glad att jag klarade av att verkligen vila ut mig och acceptera/lyssna på kroppen till 100%. Det är viktigt för att i slutändan se bäst resultat! Ha tålamod! Patricia var min personliga tränare idag (haha), jag vill nämligen inte lyfta med alla biffar själv så hon följde med mig och hjälpte till, stöttade mig och pushade till det extra.

Jag värmde först upp med 10 minuter på roddmaskinen, ett hett tips för att värma upp hela kroppen! 
Därpå började jag med bröst. Hantelpress liggandes 5 set (12 reps). --> sedan biceps (hammer curl & raka curl), 5 set på dessa också med 12 reps på varje arm. --> när armarna var fullkomligt döda övergick jag till att köra superset med bröstpress i maskin sittandes varvat med bröstflyes i maskin. Sist men inte minst mage! 3 st set med situps i maskin (50 ggr vardera = 150 st sammanlagt) och sedan avslutade jag med plankan 1 min x 3. ---> därefter det efterlängtade CYKLING PASSET i 30 minuter! 

Sats har kommit med nya klasser och nu heter cyklingpasset jag kommer gå på varje måndag 30-20-10 istället för cykling. Det bygger på att man cyklar lätt i 30 sek, sedan hårt i 20 sek och sedan 10 förgävliga sekunder så det bränns i hela benen. Det var första gången jag var på detta passet och det kommer jag fortsätta gå på! Det var väldigt intensivt (självklart blir det vad man gör det till) och jag kände verkligen att, herregud vad syreupptagningsförmågan kommer stiga! 30 minuter fungerar så mycket bättre för mig istället för 55 minuter. 

Hann med stretching i 15 minuter också efter passet. Mådde väldigt illa och kände att jag behövde svettas av mig innan kläderna skulle på och jag skulle gå till bussen. Nu förstår ni hur bra start på veckan jag haft va? Jag är så lycklig, jag är så glad, jag älskar den här känslan, jag är beroende av den. 

Ingenting kan få mig på sämre humör nu :) Inte ens vetskapen om att jag måste plugga nu, inte ens det får mig på sämre humör för jag är så brutalt glad så det bara sprudlar endorfiner i hela min kropp!

JAG ÄR TILLBAKA PÅ BANAN

Och det känns helt obeskrivligt U N D E R B A R T. 
Har precis värmt upp med rodd och nu väntar många hårda minuter. Energin sprudlar!

Sovmorgon gör susen!


Gröt, keso och hallon med! Bra start på veckan och nu ska jag till skolan för lite prov, lektioner och lunchhäng med Gretch. Sedan ska jag och Patricia gymma. Kommer hem sent ikväll, äntligen! ;) 


TAGGATAGGATAGGATAGGA


Hur taggad jag är på att äntligen få träna imorgon går inte riktigt att beskriva med tillräckligt starka ord. Det kryper i hela kroppen och jag har på känn, jag kommer vara 100% imorgon, så stark, så grym! Nu jävlar ska kroppen formas hörrni. Först vääldigt mycket kondition i över ett halvår och nu går jag över till hälften styrka hälften cardio. Har på känn att det här kommer visa grymma resultat bara inom en-två månader. Känns ju rätt bra att vara på god väg till slut-målet när alla andra precis börjat ;) okej lite skadeglädje är faktiskt okej! 

Nu ska jag ta lite kvarg för att bli extra stark imorgon! (Mår verkligen så himla bra idag på tal om ingenting)

Q/A

Ja, du får gärna ge tips på hälsosam snacks! Jag är rätt kräsen när det gäller mat och tycker varken om yoghurt, kvarg, bär, många sorters nötter osv. Har du tips på en bra frukost som inte innehåller så mycket kolhydrater? Du brukar ofta äta kvarg med bär som mellanmål eller liknande, men eftersom jag inte tycker om det vill jag gärna ha alternativ! Till frukost äter jag nu havregrynsgröt, stekta ägg med tillbehör eller knäckebröd. Äggen är ju ett bra alternativ, men jag hinner sällan ställa mig och göra de och diska efter osv.. Kram!

Svar: I see! 

LCHF bröd, med väldigt låg kolhydratshalt, dessutom väldigt goda! Finns att köpa överallt. Det kan du toppa med kalkon och grönsaker, möjligtvis lite keso om du gillar det.


Det här surdegsbrödet från Wasa är jätte gott och bra. Ligger på ungefär 40% kolhydrater vilket är relativt lite.


Tro det eller ej, det här brödet är nyttigt, trots att det är vitt. Hög proteinhalt och helt utan socker givetvis. 


Skorpor till frukost är ju inte helt fel det heller. Dessa även med låg kolhydratmängd. 

Zucchini lasange! (inga kolhydrater)

Den blev verkligen jätte god!
Här är receptet:
500 g nötfärs
2 st zucchini
1 gul lök
2 vitlöksklyftor
kokosolja 
salt och peppar
3 dl krossade tomater
1 lagerblad
oregano
1,5 dl matlagningsgrädde

Gör såhär: Sätt ugnen på 200 C. Skär zucchinin i skivor på längden. Salta på båda sidor och låt vattna ur i 30 minuter. Skölj och torka av. Hacka lök och vitlök. Stek nötfärs, lök, vitlök i kokosolja och salta och peppra. Tillsätt tomater, lagerblad, oregano och grädden. Låt koka en stund. Varva sås och zucchini i en smord form. Gratinera i ca 30 minuter. Servera med sallad. (Om man inte vill köra kolhydratsfritt kan man tillsätta lasagneplattor och ta bort zucchinin. Det blir i vilket fall som helst en god köttfärssås som också kan användas som sådan) 


INGEN NEJ INGEN VILL VARA ENSAM

Blev en fika med Ebbus och Jenny idag hela eftermiddagen. Massa myshäng och prat. Efter det åkte jag och pappa och handlade och nu har vi ställt in middagen i ugnen. Hoppas det vi gjort blir gott! 

Smarrismaskens - mitt sätt att göra tacos


Man behöver inte något bröd, massa tacosås, gräddfil eller annat tillbehör. Det räcker med massor av grönsaker, en klick keso och proteinet. Nu ska jag iväg!

DAGS FÖR LITE SOLLENTUNAHÄNG


Har haft en ypperligt underbar morgon! Ätit frukost i min takt, legat i sängen tills jag känt för att kliva upp, gjort en god lunch med pappa, städat mitt rum och fixat mig. Älskar att ha ordning och reda i mitt rum. Nu har pappa slipat golvet där nere också så snart kan jag flytta ner till mitt nya rum! 

Jag gillar faktiskt söndagar! Kanske för at jag får träna imorgon och har på känn att den här veckan kommer bli en av de bästa någonsin. Så taggad på känslan efter en vecka med nya träningsschemat, så taggad på att bli starkare och stadigare!

MÅL FÖR MIG

Jag är väl medveten om att min kontroll och mitt tankesätt är fel i de flesta lägen. Att jag säger rätt saker till er, hur ni ska tänka för att se resultat, hur ni ska göra, faktum är att inte ens jag tänker så som jag säger till er. Jag vet att det är rätt, men det går inte in i mitt huvud. Det är en kamp, och där stoppar det. Jag säger till mig själv, jag vet vad som är rätt men jag får inte in det. Visst, jag har kommit till insikt, men nu måste jag ta nästa steg. Sluta tänka så. Därför har jag satt upp mål för mig själv, mål som jag ska nå. Idag vill jag avråda alla att äta/träna som jag, men mitt mål är att leva så som jag lär ut. Så som jag egentligen tycker är sunt. Jag vill inte att någon ska göra som jag, för jag vet vad det leder till och det är inte sunt. Här kommer mina mål: 

- Sluta titta på kaloriinnehåll, sluta räkna kalorier helt
Väga mig högst en gång i veckan
Tvinga mig själv att tänka i bättre banor 
Leva efter hur jag lär
Förstå att min kropp behöver mat och att det inte är något dåligt
Lita mer på mig själv
Trappa ner på kontrollen en aning
Lyssna på min kropp mer, den vet alltid bäst


Det räcker inte med att veta, veta hur jag tänker och att jag borde tänka annorlunda. Jag måste börja, börja tänka annorlunda för att må bättre. Jag måste tro att jag kan, för då kommer jag kunna. 

Q/A

Kanske en lite privat fråga men hur mycket tjänar du på att jobba extra på mcdonalds? Och vad sa du liksom i intervjun? Eftersom man går i skolan så kan man ju inte jobba hela tiden eller jobbar du bara på helger? :-)

Svar: Ingen fara! Jag jobbar på Mcdonalds 1 gång i veckan, på lördagar 11-17. Kallar dem in mig så kan det hända att jag jobbar mer, jobbar över, får gå hem tidigare, hoppar in en söndag, eller på lov. Jag kan även boka egna pass om det finns tomma platser ibland, som på lov eller liknande då många är bortresta. Hur som helst, jobbar jag bara 4 ggr på en månad får jag ungefär 1700 kr om jag minns rätt. Fast för december kommer jag nog få väldigt mycket mer eftersom jag jobbade mycket under jul :) 

Intervjun.. Hmm, den var inte alls lång (cirka 10 minuter) och hon som jag pratade med var väldigt snäll. Först fick jag fylla i en blankett, frågor om mig själv (var jag bor, hur gammal, namn, mina starka sidor, svaga sidor, när jag kan jobba, vilken typ av person jag är, varför jag vill jobba på Mcdonalds osv) och sedan kom hon tillbaka till mig och då pratade vi om mina svar tillsammans. Nää, precis, men när du söker jobb på hemsidan så har du redan fyllt i när du kan tänkas jobba innan du går på intervjun :) 
 
Vilka bloggar eller instagram konton brukar insperera dig?

Svar: Bloggar: Svettlukt.myshowroom.se, fitspooration.blogg.se, lisapt.se, linneatheodorsson.myshowroom.se, fightingtogetfit.blogg.se, ingridkatarina.wordpress.com, letsgethealthy.devote.se, iform.se, blandannat.
Instagram: ingridkatarina, fitsuccess, j_foreverfit, forbreakfast, strongisthenewskinny94, fitspooration, emeliesarkijarvi, dorisldk, fitnessbyannie, sofieseverinsson, ptlisa. 

Blir ni inte sugna på något att äta framför tvn? Särskilt din kompis som kanske inte har samma livsstil som du? Vad äter ni i så fall? Stor kram!

Svar: Alltså, nääää, inte jag iallafall. Efter jul har vi så otroligt mycket onyttig mat hemma, eller ja, knäck, choklad, julmust och hela den där biten, så när mina vänner kommer hem till mig göder jag dem med mat. Haha, så det är inte så att när jag umgås med mina vänner så äter dem inte bara för att jag inte gör det. Jag vill ju verkligen inte att dem ska känna så! Igår när vi var hemma hos Ollie hade dem laddat upp med allt man kan tänka sig, det är bara att jag avstår men det är ingen stor grej. Nu äter jag ju kvällsmål vid 9-10 tiden så magen är glad när jag går och lägger mig :) Jag äter aldrig något för att jag känner mig sugen, jag äter när jag ska, dvs. mitt kvällsmål (kvarg, bär) men om du vill kan jag skriva ett inlägg om nyttiga snacks? Det finns massor! 

Hittar inte receptet längre ner i arkivet :) skulle vilja testa dessa då de ser supergoda ut!

Svar: Här är receptet på brödet!

Sätt ugnen på 150-175 grader, beroende på ugn

Blanda ihop detta i en bunke:
3 ägg
2 msk majonäs
2 msk keso
2 tsk bakpulver
Rör sedan ihop ovanstående
Tillsätt sedan:
1 dl kruskakli (ej vetekli)
1 dl linfrön
1 dl oskalade sesamfrön
1 dl solrosfrön
1/2 dl kokos
1/2 dl pumpakärnor
 
Frivilligt: 2 dl riven ost

Ta fram en halvstor plåt (hyfsat liten) och lägg smörpapper på. Sedan brer du ut degen på plåten så att den blir jämn, inte allt för tunn eller tjock. Platta till den och bre ut över hela plåten. Ställ in i ugnen i 20 minuter!

FRUKOST:

Fiberhavregryn med hallonfroyo, jordnötssmör och hallon på toppen!


SHE RAN AWAY IN HER SLEEP AND DREAMED OF PARADISE

Jag kan inte beskriva hur skönt det var att sova ut idag, utan någon väckarklocka som rang, utan ett alarm på mobilen, bara jag som avgjorde när jag skulle vakna. Förut kunde jag verkligen sova till 12-1 varje dag men nu tar det stopp vid redan 10, senast. Men älskar när man verkligen får sin sömn, har sovit så bra inatt. 

Nu ska jag upp och göra frukost, svin hungrig!

ZARA LARSSON

 



Kvällsmål:


Fredagens middag:

Blev tacos. Det är verkligen standard för hela Sverige på fredagar, verkligen. Nu har vi iallafall precis ätit och ska börja kolla på film. Super mysigt!

Imorgon ska jag bara plugga, verkligen BARA. Känner mig inte helt frisk så ska känna efter imorgon och därefter bestämma mig för om jag ska gymma eller inte. Det visar sig med tiden!


Känslan är ju bara för underbar

När man jobbat klart! Har haft rätt ont i huvudet hela dagen (av ingen anledning) så det var inte så roligt att jobba idag, men vad ska man göra. Det kunde varit värre! (Jag kunde haft inget jobb alls)

Blir tacos ikväll hemma hos Ollanbollan!


Lördag morgon innebär:


Jobb. Nu känner jag mig mycket bättre än igår men fortfarande rätt förskyld. Laddade upp med en portion fiberhavregrynsgröt med keso och hallon på! Keson har varit jätte konstigt de senaste gångerna vi köpt dem, men nu var den perfekt! 

Idag är det en sådan dag då jag liksom inte har orken att stå på Mcdonalds och vara trevlig mot kunderna i sex timmar när jag egentligen skulle vilja skrika: gå här i från så jag slipper prata med er. Det är en sådan dag jag kommer försöka undvika att kunderna går till min kassa och istället till någon annans. Men cash is king som man brukar säga! 

Vad inspirerar er?

Har legat och funderat på det en stund, vad som egentligen inspirerar mig. Och jag har kommit fram till att det bland annat är 1. tjejer i min ålder som tränar mycket och är diciplinerade 2. Snygga kroppar 3. Fitnessbloggar 4. Se alla olika människor på gymmet 5. Söka runt på internet om fakta om träning&hälsa. Dessa ger mig inte bara inspiration utan också motivation, men den första är verkligen så solklar, jag får så mycket inspiration av andra tjejer som verkligen tränar och äter sunt. Jag kan verkligen se upp till de människorna, därför blir jag så irriterad att jag inte kan inspireras lite mer av mig själv. Det finns en anledning till att jag ser alla de där tjejerna på gymmet, det är för att jag hänger där i princip varje dag ju! (TA IN DET I DIN HJÄRNA NU TACK VICTORIA) 


Det är fredag och en bra sådan. Emma har åkt hem nu och jag ska sova snart. Känner mig kaosalt trött (är det ens ett ord?) och vill inte ens tänka tanken av att behöva jobba imorgon. Tur att man efter jobbet ska till Ollie och äta middag (tacos) med alla tjejerna. Kan ju inte bli bättre! 

YUMYUM

Köttfärsbiffar (med fetaost och oliver i) från persys kött (kött affär som har jätte bra kött) med bönor, keso och sallad! Kan inte bli bättre!

Nu kollar jag och Emma på gladiatorerna och vi kommer nog stanna i soffan hela kvällen! :)


MYS MELLIS I SOLLENTUNA CENTRJM

Provet gick galant, känns riktigt bra! Efter skolan åkte jag och träffade min efterlängtade Emma, vi fikade på espresso house och pratade en massa. Jag åt två skivor av mitt egna bröd med kalkon och paprika på. Gott var det! Men nu har vi kommit hem till Emma och ska snart powerwalka hem till mig. Ska äta godaste middagen idag, åh så gott det ska bli. Lägger upp bild sen!


FREDAG FREDAG FREDAG


OSMINKAD BRUD

Men jag orkar verkligen inte bry mig när jag är så här förkyld! HEJ spöke..


Dagens lunch:

Ägg/kalkon omelett stekt i vitlök och kokosolja med salt och peppar som kryddor.
Till det sallad bestående av isberg, avokado, spenat och fetaost!

Nu ska jag kila iväg till skolan för matte, historia och ett geografi prov. 
Känner mig en aningen bättre idag, men det är inte mycket. Rinner fortfarande och nyser som en tok!
Efter skolan ska jag iallafall till sollentuna med Emma, hon kom nämligen hem från Egypten igår!


Q/A

Från och med nu så svarar jag på era frågor på söndagkvällar! Ni kan självklart fråga vad ni vill/när ni vill men jag kommer sammanfatta alla frågor i ett inlägg på söndagar istället. Låter bra?

Sovmorgon - frukost

Man tager vad man haver! Gjorde en kaffe-gröt idag, super gott! Så här gör du:

1 dl havregryngröt
2,5 dl vatten
1 kryddmått salt
2 msk kaffe

Jag hällde i kaffet först när gröten var klar och sen rör du bara om. Blev verkligen jätte gott!


Q/A

om man äter lite och kroppen ställer in sig på svältläge och man går ner i vikt, går man upp i vikt lika fort sen ?

Svar: När du börjar äta mer mat går du givetvis upp i vikt! Det är därför det är ofta som de som går på extrema dieter (tex soppdiet) ofta går upp när de börjar äta vanlig mat igen!

Q/A

Hej, har en fråga. Har hört om folk som gått ner i vikt snabbt och endast ätit lunch och middag då, alltså 2 mål per dag. Är inte det för lite? Och vad händer om man äter så lite, ställer kroppen in sig på svält då? Och blir träningsresultaten sämre även om viktnedgången sker snabbare? Undrar verkligen eftersom jag tycker att det inte låter hälsosamt att äta så få gånger per dag.. Förresten så bör det tilläggas att maten vid denna slags diet varit ungefär så som dina tallrikar ser ut, alltså hälsosamma!

Svar: Det är på tok för lite och för sällan! Ja, kroppen ställer in sig på svältläge, totalt. Det blir inga resultat från träningen, du kommer nämligen inte orka träna om du äter så lite. Kroppen får ingen energi. Det enda du blir är ben, det blir en viktnedgång för att du äter så lite, men du svälter dig själv och det är inte sunt. Du kommer heller inte få en sund kropp genom denna metod. Ät 4-6 gånger om dagen istället nyttigt, se till att få i dig det du behöver och träna rätt så kommer du se grymma resultat! :) 

Det här är helt fruktansvärt hörrni

Jag är helt utmattad efter att nysa hela tiden, snyta mig varje kvart. Det rinner dessutom ur ögonen och kliar något förbannat. Nu har jag som tur är kommit hem och ska börja med middagen snart. Ensam hemma ännu igen så det blir något av mitt eget. Vi får se vad jag orkar röra ihop!


Q/A

Postat av: Linnes

Hej! Du är verkligen en stor inspirationskälla måste jag säga! 
Jag undrar om du inte kan lägga upp mer om HUR du lagar maten du äter? 
Sen undrar jag om du har några tips på hur man ska känna behålla fokus i träningen och kosten? Jag har väldigt lätt för att börja med det och sen faller jag tillbaka. Hur ska jag kunna fortsätta? För de är verkligen de jag vill. Hur viktigt är det med mål med de man gör? 
Just nu tränar jag regelbundet och har även lagt upp ett kostschems. Hur tycker du man borde äta och röra på sig för att gå ner 1/2-1 kg/ veckan?? 
Hur har din resa sett ut? Vid vilken vikt började du? Och hur ser det ut nu? Kan du inte berätta lite. 

Keep up the good work! /linnea

Svar: Om jag förstår rätt så är du en ny läsare? Många av de här frågorna har jag svarat på ett flertal gånger om du bläddrar ner i arkivet men självklart kan jag ge dig lite tips och berätta lite :) 1. Jag kan absolut börja skriva och lägga upp bilder på hur jag gör min mat, det verkar vara populärt så det ska jag börja göra mer! 2. Ha tålamod! Det kommer inte gå på en dag men du kommer se resultat om du fortsätter, tro mig det kommer! Sätt upp tydliga mål, det är väldigt viktigt, speciellt om du har lätt för att hamna "off track". Något du också kan göra om det håller dig motiverad är att ta en dag i veckan (lördag eller fredag) då du unnar dig någonting. Då snackar vi inte en hel ätardag där du trycker i dig allt du får syn på, men tex. en fika eller något gott till kvällsmyset. När du ser resultat kommer du också bli motiverad att fortsätta i samma riktning! 

Hur mycket du ska äta är svårt att säga, jag vet ju i princip ingenting om dig! Men vill du gå ner i vikt så ska fokuset ligga på konditionsträning. Du bör äta regelbundet (cirka var 3e timme), dra ner på kolhydraterna (om du känner att du verkligen vill äta kolhydrater så kan gröt vara bra alternativ som frukost, kolhydrater före träning är också bra för att få energi), äta mycket grönt, få i dig rätt fetter (vegatabiliska fetter som avokado tex.), inga halvfabrikat (köttbullar, pyttipanna, falukorv) och drick mycket vatten! Se till att inte småäta utan ät istället många gånger (4-6 ggr om dagen) och mindre måltider! 

Jag började på 66.7 kg och nu väger jag ungefär - 11 kg. Jag började i Mars förra året så snart har det gått ett år. Det har varit en väldigt lång resa, men värd varenda sekund av svett och tårar kan jag säga. Hela förra året var jag väldigt bestämd på att jag skulle nå dit jag ville och att ingenting skulle komma i vägen. Det tog mig många år att hitta den styrkan och ta tag i det kan jag säga. Men när jag hade gått upp 8 kg på ett år så nådde jag den punkten. Eftersom jag är sjuk just nu har jag inte kunnat träna på tre dagar och det seriöst kryper inom mig, träningen har blivit en så stor del av mitt liv så att idag vet jag inte vad jag skulle göra utan den. Jag har inte haft det problemet att jag bestämmer mig och sen faller jag tillbaka riktigt, utan jag gick verkligen in för det här och bestämde mig en gång för alla och vipps. Här står jag idag. Jag vet att jag inte hade klarat av mig själv om jag inte gjort det här, jag hade blivit för besviken, kännt mig för misslyckad och det är nog en stor anledning till att jag verkligen klarat av det. Rädslan för att misslyckas har gjort att jag gett 100% istället för 75%. När man går in i något med hela sin själv blir man mer sårbar och därför har jag helt enkelt inte tillåtit mig själv att ta en sovmorgon när jag har gymmet att gå till eller äta en scones till en fika, jag har hållt mig till min kvarg varje fika istället under hela hösten. Du måste bara hitta styrkan inom dig. Om du fortsätter att "jojjo banta" (gå fram och tillbaka, menar inte att du bantar men du förstår) och inte riktigt bestämmer dig en gång för alla, då är sanningen hård men: du vill det inte tillräckligt mycket. Du kanske vill men jag lovar, din kropp stoppar dig inte, det är ditt huvud. Men jag tror på dig kom igen nu, tiden kommer fortsätta gå trots att du inte tränar så se till att den räknas! Jag har ett mål för dig, se till att följa din träning och kostschema i en månad från idag. Börja imorgon! Den 11 februari får du unna dig något alldeles extra! Jag vet att du klarar det!


Lunch i skolan:

Tror aldrig jag visat er en bild på maten i skolan, eller åtmistone när jag äter i skolan. Äter ju inte skolans mat men äter ju fortfarande här ;) idag tog jag med mig lax och sallad. Blev lite lite lax (bara 130 gk) så jag la till lite keso och broccoli/gröna bönor som fanns i skolan. Super gott!


TORSDAG MORGON


Och jag kan inte bli gladare! En dag närmare tills jag kan träna! Känner mig lika förskyld idag och nyser stup i kvarten så det är dock inte så roligt. Men jag planerar att jag är tillbaka på söndag. Då har jag vilat ut mig rejält! 

Nu har jag dessutom ätit en super god frukost. Quinoa gröt med keso, en halv matsked jordnötssmör och hallon. Eftersom jag blir hungrig i skolan vid ungefär klockan nio igen (och jag har lunch halv 12) så vill jag få ut mättnadskänslan lite. Så idag blandade jag i ett ägg i gröten och ställde in den i mikron i 4 minuter. Blev ännu godare och som plus åkte proteininnehållet upp också! Kan verkligen rekommendera er det :) 

Nu blir det en lång dag fylld med håltimmar, slutar 4 och sedan ska jag och mamma iväg på stor handla! 


MEN VERKLIGEN


Har fastnat för "Losing it with Jillian Michaels" nu. Kollat på flera avsnitt på youtube idag, verkligen inspiration, rekommenderas. Hon är verkligen läskig den kvinnan, på ett bra sätt. Beundransvärt! 

Min näsa bara bli värre och fortsätter rinna och rinna, det är faschinerande hur mycket snor man kan ha i en näsa alltså. Halsontet har försvunnit men förskylningen blir värre. Galen!

Kvarg utblandat med mjölk toppat med hallon!


Hörrni, jag tror säkert det finns vissa av er som läser det här just nu som är lite småhungriga. Men som tänker att dem inte ska äta nu för att det är sent, att istället vänta till frukosten är bättre. Nej. Gör. Inte. Det. Nu har jag börjat, och kommer fortsätta äta kvarg och hallon 2-3 timmar efter min middag. Just för att middagen oftast brukar vara mellan 6-8 och då är det perfekt att äta sista målet vid 10 tiden. Jag blir nämligen hungrig efter bara 2 timmar typ. Måste bli bättre på att inte äta för lite protein till lunch/middag, de senaste dagarna har det blivit runt 130-140 g / vardera vilket är för lite. Jag ska ligga mellan 150-200 g. Hur som, magen mår bättre och kommer vara tacksam om du inte väntar till att äta morgonen efter om du är hungrig innan du ska gå och lägga dig, tro mig. Du kommer tjäna på det i längden! 

Nu har jag pluggat klart för ikväll, gjort klart allt för imorgon bitti (lagt fram kläder, lagat lunch, städat rummet, packat väskan) så nu ska jag bara njuta av att kolla på premiäravsnittet av pretty little liars. Någon av er som kollar på det? Jag har varit fast sedan start och får fortfarande aldrig nog. Kärlek det där!

CHICKENSALAT

Mamma ska ÄNTLIGEN handla imorgon, går runt som en tok och väntar på det. Hehe! I dagens ära gjorde jag en kycklingsallad iallafall av det vi hade hemma. Stekte bara upp kycklingen med kokosolja i stekpannan och sedan tog jag lite avokado, isberg/ruccola/grönkål, paprika och fetaost. Perfekt blandning!

Nu återgår jag till plugget. Har precis börjat trots att jag varit hemma sedan klockan två ;) men jag har mitt nya motto "jag pluggar inte för jag har bättre saker för mig" vilket stämmer in rätt bra för mig :)


Mellis-time:

Här får ni ett tips på en jätte god och lätt smoothie. Har blivit lite trött på det vanliga, yoghurt/kvarg med bär så istället gjorde jag en smoothie av det. 2 dl naturell yoghurt, 1/2 dl ica kvarg (10% fetthalt) och 50 g hallon. Vill du bli mättare/öka mättnadskänslan så kan du bara byta ut yoghurten mot mer kvarg! :)


Q/A

Postat av: Veronica

Heeeej Viggo! Har läst din blogg länge nu och vill bara säga att dy är GRYM! Du tränar som fan (ursäkta språket). Ärligt talat jag tror inte du själv inser hur grym du är! Vill bara att du ska få bättre självförtroende för du förtjänar de! Du har gått upp tidiga mornar och äter sjukt nyttigt! Haha seriöst du är bäst! Du har fått offra mycket och det syns verkligen! Victoria jag tycker verkligen att du är sjuuuuukt grym som du kanske har märkt nu! Krya på dig nu och tänk på hur mycket du har tränat, så även om du är sjuk så förtjänar din kropp och du lite vila. Vet att du vill ha fastare och DU KOMMER ATT FÅ DET! Tycker redan att du har det men som sagt man måste vara nöjd själv och jag hoppas du blir det efter mars!Och sen har jag en fråga: hur gör du köttfärsåsen? Ha en bra kväll! FRÅN DITT NÄST STÖRSTA FAN..eftersom du redan har en första haha kram!

Svar: Tack tack tusen tusen miljarder gånger om! Verkligen skönt att höra det där från någon annan, verkligen. Köttfärsåsen kan jag lägga upp receptet på i ett annat inlägg :) Haha! 

 
Postat av: Ditt supernyfikna fan

Hur är det med oliver och chevre? Är det nyttigt? Och varför??

Svar: Oliver är jätte nyttigt. Det är nämligen så att oliver innehåller enkelomättade fetter vilket är den typ av fett som vi verkligen behöver få i oss! Chevre ost innehåller mycket mättat fett (som också finns i smör, andra ostar eller feta mejeriprodukter. Äts av många som använder LCHF) och som med allt finns det delade meningar om vad som är nyttigt och inte. MEN att äta lagom mängd av mättade fetter är självklart bra. Sen har vi omättade fetter som anses vara de "nyttigare" fetterna. Fisk, vegatabiliska oljor, olivolja, avokado osv. Nyttigt fett! Du behöver dock inte vara rädd för de mättade fetterna, vi behöver få i oss båda :)


Svara ja eller nej, ja eller nej

Vad mumsig frukost det blev! Saffran gröt med keso och bär, jag vet att julen är över men jag kunde inte hålla mig heheh. Nu ska jag till skolan för tre tråkiga långa lektioner. Redan onsdag, konstigt.

Hörs sen!


Släktkalas hemma hos moster:

Min kusin Erik fyller år idag och därför är vi hemma hos dem och firar honom. Mysigt att umgås med min släkt också, dock inte lika mysigt för mina öron, ljudvolymen är ju inte den mysigaste ;) jätte god mat blev det iallafall. Jag tog sallad med köttfärsspätt och kycklingspätt, starkt och gott! :)


Q/A

Postat av: Anna

Vart kan man hitta det i arkivet?? Är det ett tidigare inlägg? ;)

Svar: HÄR kan du hitta inlägget! :)


Q/A

tycker du själv att du är lyckligare nu utan dom där extra kilona? Älskar din blogg och din träningsglädje

Svar: nej vad läskigt, för två timmar sedan ställde jag den frågan till mig själv.. Det händer faktiskt att jag ställer mig den frågan rätt ofta. Men jag ska försöka ge dig ett så bra svar som möjligt. Det beror lite på från dag till dag. Alla har vi bra och dåliga dagar, vad dessa "dåliga" och "bra" dagar innehåller/innebär är olika för oss alla men för mig så kan jag ju säga att om jag har en dålig dag beror det idag oftast på ångest i tränings/matväg. Rädslan för att inte nå mitt mål, för att jag äter fel, tränar fel och därmed kommer få fel resultat. För ett år sedan var ångesten också väldigt upprepande men inte av samma anledning, vi kan säga den motsatta. Ångest för att jag bara satt på rumpan och blev fetare och fetare, att jag inte gjorde något åt saken. Vilken är värst? You tell me. Jag har långa dagböcker med typ självmordsbrev (låter så hemskt och det är det ju också) där jag seriöst hotar mig själv att om du inte går ner såhär mycket till sommaren då lalalalala. När jag läser dem blir jag så ledsen. Att jag mådde så dåligt när jag istället hade kunnat ta ett beslut och bli hälsosammare och må bättre. Jag trodde inte JAG kunde. Och det är ju vanligt, de flesta av oss nedvärderar vår egen kapacitet till att klara av saker och ting.

Idag kan jag nog säga att ja, jag är gladare, positivare och mår bättre i det stora hela än för ett år sedan. Men det är långt ifrån en smärtfri resa som jag gjort. Jag gick in i det här med tron om att alla problem skulle försvinna när jag var 10 kg lättare och att jag skulle leva lycklig i alla mina dar och så länge man har den synen, den uppfattningen så kommer man aldrig bli nöjd oavsett hur många kilo man tappar. Det har jag lärt mig. Allt sitter i huvudet och så länge jag inte accepterar mig själv mer för den jag är och allt jag åstadkommit hittills på vägen så kommer jag aldrig bli så lycklig som jag från början trodde jag skulle bli.

Jag är verkligen glad att jag förändrat mitt sätt att leva, hittat träningen som jag idag verkligen brinner för och är medveten om vilken mat jag matar min kropp med varje dag MEN man ska aldrig tro att viktnedgång leder till ett problemfritt liv. Det låter knäppt med det var så jag såg på saken. Jag ska inte ljuga, än idag så har jag väl kvar tanken att när jag fått fastare kropp så kommer jag bli gladare. Det är något jag försöker jobba bort hela tiden och det är svårt. Och det har krävts mycket och det krävs även nu mycket. Mycket energi. Energin som jag vill kunna lägga på annat. All den energi jag får från träning känns det ibland som jag lägger på att planera vad jag ska äta, när jag ska äta och när/hur jag ska träna. Det går inte bara att tänka bort utan det fastnar i huvudet. Och det tar otroligt mycket energi.

Så, var jag kanske inte lyckligare med 11 kg mer på kroppen för ett år sedan? Då jag kunde äta mat utan att ens fundera på hur mycket kalorier det innehöll eller hur det påverkade mig? Bara kunna äta för godhetens skull och slippa all den här planeringen som tar så mycket onödig energi? Nej, jag var inte det. Trots att jag med hela mitt hjärta önskar att jag idag hade kunnat komma hit utan att stå här med lite matproblem rikare så är det smällen jag får ta. Jag har blivit starkare, jag har lärt mig av mina misstag, jag har dessutom kunnat inspirera min omgivning och jag tycker det har varit värt det i slutändan. Men som sagt, det är lätt att allt går till överdrift, vilket det faktiskt har gjort dör mig. Men mitt i allt det här har jag hittat träningen och min nya hälsosamma livsstil som jag idag inte skulle vilja byta ut mot något i hela världen.

Tack så hemskt mycket, det är det som får mig att vilja fortsätta :)


Q/A

äter inte du typ tomat, paprika, majs? Varför om inte? :)

Svar: Jo jag äter tomat och paprika, jag äter dock inte majs. Jag har ju inte ätit mycket kolhydrater (under en period inga alls) och därför har jag uteslutit allt som heter spannmål (vete) (kolhydrater). Ingenting jag tänkt mycket på, ett medvetet val att inte äta majs men inte något vidare svårt sådant :)


BARA ATT KÄMPA PÅ

Geografi är så osammanhängade och ointressant. Har försökt plugga i typ 2 timmar men kommer verkligen ingenstans. Har läst typ två sidor hitills och de sidorna vet jag inte ens vad de handlar om.


Eftermiddags mål:

När man funderat på vad man ska äta som mellis i över två timmar undrar jag om jag inte blivit lite galen.. Jag valde tillslut iallafall. Hemmagjort fröbröd med två skivor rökt kalkon med paprika och ruccola på. (Receptet på brödet finns i arkivet)


THE LUCKIEST GIRL ON THE PLANET


Förhoppningsvis mår ni bättre än jag gör just nu. Skrev klart uppsatsen i skolan och sedan gick jag hem. Ställde mig direkt i köket och tog rester från gårdagen, köttfärsåsen är så god. Nu klarar jag mig nog i tre timmar tills jag är hungrig igen haha :) Det kliar i mina öron och det tar emot att svälja, hatar hatar det här. Men jag ska sluta klaga nu, får bara acceptera det som är. Nu är mitt immunförsvar verkligen på 0 så jag får bara se till att vila upp mig och få i mig massa vatten + näring i form av mat. 

Det gjorde min dag idag när jag fick en kommentar från "ditt största fan", var bara tvungen att säga det, jag dog. Nästan. Så gulligt! 

Nu ska jag syssla med sånt jag vanligtvis aldrig hinner med: kolla på premiäravsnittet av pretty little liars som kom ut idag. Sedan väntar timmar av plugg! 

Q/A

Postat av: förvirrad

vad är det för skillnad på vanligt havregrynsgröt och quinoa havregrynsgröt? vilket är nyttigast/bäst att äta ? och varför har du bytt? :) är det mer kalorier i quinoa gröten?

Svar: Bra fråga, skillnaden mellan sorterna är att quinoa gröten innehåller inte 100% havregryn utan även 5% quinoaflingor (dessa är ett av de mest näringsrikafröerna som finns). Jag skulle tro att quinoa gröt är en aning nyttigare, men helt ärligt köpte jag bara den gröten av ren slump, ville testa på :) Det är ingen större skillnad på kaloriernai gröterna, dock beror det självklart på vilket märke man köper. Jag köper gröten från märket frebaco och då innehåller en portion ungefär 150 kcal. Men stirra er inte blinda på det hörrni, kalorier är bara siffror, sålänge ni äter nyttigt och är hälsosamma så finns det ingen vits med att räkna kalorier eller liknande :) Håll bara koll på hur mycket du ungefär får i dig per dag så sköter kroppen resten
 
Postat av: Ditt absolut största fan

Kan inte du skriva om vad jornötssmör är bra för, om det är bra! Det är ju väldigt kaloririkt, men de åker väl fortare genom tarmarna än typ godis? Eller hur är det det fungerar!?

Svar: Det finns delade meningar om jordnötssmör, många anser att det är bra medans andra är väldigt kritiska. Självklart beror det på vilket märke du köper. Jag använder mig av märket fitnessguru och då är det 99,3 % jordnötter och 0.7 % havssalt = väldigt bra. Märken som skippy däremot innehåller massor av tillsatser, socker osv och det är givetvis inte nyttigt. Jordnötssmör är bra i små mängder, inte för mycket som med allt. Proppa inte i det 5 burkar om dagen utan håll dig till 1-2 matskedar kanske. Jordnötssmör innehåller otroligt mycket kalorier, men det är bra fetter det handlar om. Fetter, protein och kolhydrater som du behöver. Jag brukar ha lite jordnötssmör på frukosten för att hålla mig mätt längre, jordnötssmör innehåller nämligen väldigt lågt GI vilket resulterar i att du kommer hålla dig mätt längre!

Godis innehåller massor av socker och det stannar på kroppen, det försvinner inte ur kroppen på samma sätt som nötter (jordnötssmör). Jordnötter som du säger, det försvinner ur din kropp fortare och lägger sig därför inte som kärlekshantag på dina höfter. Det är en bra sorts fett som det innehåller och trots det höga kaloriinnehåller så är det nyttigt, i normala mängder. Dessutom är det ju gott också ;) 


Man får vad man förtjänar

Fan vad det känns surt just nu. Alla är vi ju väl medvetna om att man inte ska träna är man är sjuk, det vet vi ju, men när det väl är en själv som är sjuk är det åtminstone för mig väldigt lätt att övertala mig själv om att jag visst kan träna, just för att jag måste. Okej, igår kände jag mig helt okej, jag kände mig inte sjuk men nu slog det tillbaka så idag är jag mycket värre. Och nu istället för att bara ha lite känn i halsen är jag plötsligt jätte förskyld, har ont i öronen och är tillbaka där jag var i lördags, dvs. mycket sjukare. Jag blir galen på mig själv. Hade jag vilat igår hade jag kanske kunnat bli frisk till idag och inte sjuk igen, nu kanske jag måste vila i 2-3 dagar istället tills jag kan träna och då är det redan torsdag-fredag. Ett tips: träna aldrig innan ni känner er 100%. Och verkligen inte kondition om ni känner av någonting, styrka är då ett bättre alternativ. 

Får se det här som ett tillfälle då jag får tid att plugga istället. Har inte haft ett träningsuppehåll på mer än 3 dagar sedan mars förra året, nej det är sant. Kanske är det min kropp som försöker sända ut lite signaler om att den inte riktigt hänger med, eller så får jag ta sota för att jag inte hade någon halsduk veckan i Kalmar (vilket jag ALLTID har annars). Nu ska jag kämpa mig till skolan och skriva uppsats i två timmar, sedan funderar jag på att åka hem. Känns verkligen inte bra det här. Ursäkta språket men JÄVLA HELVETE.

Aptiten har inte försvunnit iallafall, blev gröt med keso och hallon idag till frukost :) 


WE ARE THE CRAZY PEOPLE


Segt att sluta 4 varje måndag nu, kröp i hela kroppen efter suget att åka till gymmet. Med 3 dagar utan träning finns det inget annat i tankarna. Vi tränade på rejält. 2 h och 15 minuter träning blev det sammanlagt. GALET.

Först värmde vi upp med rodd i 10 minuter på högsta motståndet, började då känna lite i halsen så fattade det kloka beslutet att inte gå på cyklingen i 30 minuter vid kl. 6. Bara styrka istället. Jag är lite av en tidsoptimist så att jag trodde att styrkepasset skulle hinna vara klart på 1,5 h trodde helt fel. När alla dessa nya människor är på gymmet som har alla nyårslöften och grejer tar det betydligt längre tid med att dela på maskiner osv. Skönt att dem är utflugna från gymmet igen om 2 månader ;) Skämt och sido. Blev Axlar, biceps & mage idag. Kändes riktigt bra, det blir så mycket roligare när man har någon att träna med! På vägen hem var vi båda helt ömma i armarna och kunde knappt hålla i telefonerna utan att börja skaka, hehe. Så det kan gå! 

Efter en god proteinshake var jag hemma och åt äntligen middag.

Köttfärssås och sallad! 

Nu har jag pluggat en del, fick så grov ångest när jag kom hem nämligen. Känns som jag har så mycket att ta tag i i skolan fast ändå inte. Men nu har den där ångestfyllda känslan försvunnit lite och jag känner mig bättre! Har förberett mig lite för allmänt uppsatsskrivande imorgon bitti i 2 h och geografi prov på fredag. Synd att man inte har fotografiskt minne! Vart har jag fått mina gener ifrån egentligen? 

Första dagen med nya kostschemat har gått bra. Kändes väldigt konstigt att äta ris och kalkon till mellis men jag vänjer mig nog. Nu ska jag äta en hel kvarg innan jag går och lägger mig, ni förstår inte hur konstigt det här känns!! Hur som helst, fortsätta med pluggandet, äta min kvarg och sedan hoppa in i duschen är vad som står på schemat. Vid 11 ska jag släcka lampan för klockan 6.30 ska jag upp imorgon! Fit for fight. Glöm inte sömnen hörrni, den är viktigare än man tror! 

Det är riktigt roligt att fler och fler har hittat till min blogg och instagram. Så kul att kunna inspirera er genom att bara leva mitt vanliga liv och vara mig själv! 

Q/A

Säg att man styrketränar och konsitionstränar. Lika mycket. Dvs att man styrketränar ganska tufft. Tycker du att man borde använda sig utav kosttillskott?

Svar: Jag tycker absolut man ska ta kosttilskott i det fallet, det förbättrar bara din prestation och ökar din återhämtningsförmåga så jag ser inget negativt med det, dvs. om man inte är kritisk mot proteinpulver osv! 


DAGENS MELLIS:

50 g råris med keso och kalkon!


Vad roligt att se :)

När jag vaknade imorse såg jag att jag hade fått en shoutout (stavas det så?) av en tjej som heter fitnessamanda på instagram. Så himla roligt! Hon har ändå rätt mycket följare på sitt account så det var jätte kul att kolla hur många nya följare jag fick när jag vaknade ;)

Nu sitter jag iallafall och väntar på att min lektion ska börja, geografi. Känns seeeeeegt som attans men det är ingen lång dag idag så det löser sig :)


Måndagen då skolan börjar

Känns inte som att skolan börjar idag. För min del har jullovet känts jätte långt, rätt ovanligt att känna så men det gör det bara ännu kostigare att börja skolan igen. Har hunnit med att njuta och göra jätte många roliga saker på lovet men ångesten kryper fram lika mycket här som för alla andra tror jag. Skulle åtmistone behöva en vecka till så är jag redo! 

Vaknade iallafall vid halv 9 idag, otroligt pigg och gick och gjorde frukost. Quinoa havregrynsgröt med kvarg, hallon och lite jordnötssmör. Super gott! 

Jag pallar inte deppa för att skolan börjar idag så jag är glad istället. Känner mig hyffsat bra idag så jag har packat väskan fylld med träningskläder, mat och drycker som ska fyllas på innan under och efter passet :)

Hoppas ni får en bra dag, nu måste jag skynda mig till bussen om jag ska hinna! 


Har på mig min nya kofta från JC och jeans från vila clothes


ÅRSRESUMÉ - 2012


Spenderade många eftermiddagar på espresso house med fina vänner

Festade väldigt mycket i början av året

I januari-februari blev det många myskvällar med onyttigheter

Sjöng i sollentuna centrum

Var på en galen brunch hemma hos Sofia med alla brudarna

Åkte till Romme 

Tjejmiddagar för fullt - denna gång hos Ebba när hon fyllde år

Åkte till Sälen på sportlovet med min super pingla Sanna till vän

Spenderade många lunchraster i solen med min härliga mentorsgrupp

Gick på en Tyler Ward konstert i Stockholm och lärde känna nya filurer

Köpte gymkort på sats i Mars

Gick på rockskivan (åtmistone middagen) med Hanna

Massor av mysa film-tjej kvällar hos Hanna under påsklovet med andra ord och té

Början av sommaren var fylldes med mysiga kvällar med mina närmaste

Hanna och Sofia hade deras 17 års fest

Jag tränade som satan

Mös i en park med bästavän

Det blev sommarlov och världens bästa syster tog studenten

Ännu fler tjejmiddagar hos Viggo

Åkte spontant in till Summerburst och flörtade med vakterna - slutade med att jag Räkan och Ebba stod längst fram när Guetta spelade
 

Åt mängder av jordgubbar
Världens bästa åkte till USA så vi spenderade vår sista kväll hemma hos mig med finmiddag i klänningar och klackskor, målade våra ansikten i blått och rött och grät och skrattade som aldrig förr

Tränade ännu lite mer

Åkte till Emmas landställe i Skåne

När jag kom hem hade jag och Jenny reunion

Jag kunde cykla hem i linne efter träningarna

Åkte till USA över sommaren helt själv

Shoppade upp alla pengarna

Var på young americans camp i en vecka i USA. Sjöng, dansade, spelade teater i en hel vecka och alla vi 150 lyckades bli som en familj. Var jobbigt att säga hejdå.

Jag och Matilda bakade till Jenny som fyllde 17 år

Tränade med Patricia

Färgade ögonbrynen

Pernilla fyllde år så jag, Ebba och Sofia blev bjudna på kvälls fika hemma hos henne

Tvingade med snyggot till sats för att träna

Spenderade många eftermiddagar på gymmet efter skolan

Skypade massor med Annisen

Började jobba på Mcdonalds

Åkte till Göteborg med Emma för att gå på Tyler Ward - köpte med mig halva starbucks också

Tvingade Jenny att klia mig i håret

Jag gick ut och sprang varje söndag
Jag fylle 17 år så det blev tjejmiddag hos mig med alla tjejerna

Åt MASSOR av kvarg

Detta blev mitt andra hem

Levde på nyttig mat

Gick ner massor i vikt

Många roliga kvällar med min bästavän

Åt sallad till varje måltid

Lärde mig att älska frukostar

Träning blev vardagen

Julen kom lika fort som det gick

Åkte till Kalmar och tränade massor med Andreas

Firade mitt nyår hemma hos Carro

Dagen efter

Ändrade om träningen lite

Mitt nya matschema:

Nu när jag ska börja styrketräna mer (och träna längre pass i allmänhet) så kommer jag lägga om min kost. Från äta på ett ungefär äta inga kolhydrater ska jag börja äta lite kolhydrater och från att äta en kvarg till frukost och mellis ska jag äta.... Här kommer det! 

Frukost: 7.00-10.00 Kommer bestå av 1 dl quinoa havregrynsgröt. Till det kommer jag ha lite kvarg/keso med bär och möjligtvis lite jordnötssmör! 


Lunch: 11.30-14.00 Här har vi samma mål som jag alltid ätit. Protein (kyckling/kött/fisk/ägg) med sallad.

 
Mellis: 15.00-17.00 Här kommer den nya delen! Jag har flera alternativ. Mitt mål ska bestå av cirka 56 g kolhydrater (då man brukar räkna att 1g kolhydrater per kg är en bra utgångspunkt 30-60 min innan träning). Jag brukar oftast träna efter mellis och då kommer mina alternativ se ut såhär: 
- Protein (kyckling/kalkon) med cirka 56 g ris/potatis
- 2 riskakor med kalkon eller jordnötssmör på
- 2 mackor med kalkon och keso på
- 1 dl quinoa havregrynsgröt toppat med kvarg/keso och bär

Om jag inte har lagt en träning efter mellis så kommer jag äta 125 g kvarg med bär. Om det är ett pass innan lunch är det frukosten som kommer vara preworkout måltiden och då är det gröt som gäller. 


Middag: 18.00-20.00 150-200 g protein (kyckling/ägg/fisk/kött) med sallad (möjligtvis toppat med lite nötter)


Kvällsmål: 21.00-22.00 125 g kvarg med bär


Sedan kommer vi till mina kosttillskott. Innan träning kommer jag ta något som kallas craze.

Craze är en prestationshöjare, du får ökat fokus, energi, kontroll och eufori. En pwo som gör en lite galen ;) Nej skämt och skido, men den gör dig piggare och ökar din prestationsförmåga. Ingen uppförsbacke på spinningpasset är för brant och ingen vikt för tung ;)

Denna kan du tex. hitta på gymgrossisten för 399 kr.

Under passet kommer jag blanda ut mitt vatten med cellmax. 

Cellmax är en återhämtningsdryck men fungerar också att ta under träning. Jag kommer ta en halv liten skopa cellmax under träning som jag blandar ut med mitt vatten för att bibehålla energi. (Cellmax innehåller nästan bara kolhydrater).
 
Denna burk på 4000g kostar 698 kr.

Efter träning kommer jag återhämta mig med en proteinshake. Den heter Whey white chocolate protein powder. 

(Det är inte exakt denna jag tar men det var den närmaste jag kunde hitta, den jag tar kanske inte finns på marknaden, hur som helst är den här relativt lik). Det här pulvret är då till för återhämtningen. Det innehåller viktiga aminosyror för att reparera och bygga muskelatur och gör att jag återhämtar mig fortare inför nästa träningspass. Jag kommer blanda 1 1/2 skopa av denna med 3/4 skopa av cellmax.

Denna burk kostar 649 kr. 

cirka 1-2 h efter jag druckit min proteinshake kommer jag äta lunch/mellis/middag. 

Är det något mer ni vill veta? :)

Sista middagen den här veckan:


Ibland undrar jag vad det är för fel på mig. När jag kom hem från jobbet var jag svinhungrig och jag hade sagt till mamma innan att jag antagligen skulle vara hungrig när jag kom hem vid halv 7-7 så hon sa att maten inprincip skulle vara klar då. När jag kommer hem står fisken orörd i påsen och mamma var inte ens hemma. Ringde henne och då var hon på ica och handlade men skulle skynda sig hem för att börja med maten. 

När hon kom hem frågade jag om vi hade någon annan mat som gick fort att laga eftersom jag inte kunde vänta så länge som fisken skulle ta. "men jag ska ju göra fisk nu!" sa hon då istället. MEN HALLÅÅÅÅ (när jag är hungrig blir jag jätte irriterad) jag kan ju inte vänta en halv timme till, jag DÖÖÖR snart. Gissa vad jag gjorde när jag insåg att jag skulle behöva vänta med att äta 30-40 minuter till? Jo, jag började gråta. Gick in i mitt rum och grät. SÅ JÄVLA TÖNTIG JAG ÄR. Hörde då mamma ropa från köket "men ta en avokado innan då!" men hallåååå, jag småäter inte!!!!!!!!!!!!!!!!!!! Jag är riktigt töntig jag vet, men när jag är hungrig vill jag ha mat bara så det är liksom. Fick iallafall min fisk vid halv 8. Jag vet att jag lagt upp receptet tidigare så för er som är nyfikna är det bara att kolla i arkivet! Den är supergod :D 


bara Amadeus och jag kvar nu..


Eftersom Michaela har flyttat till Norge nu så bor jag ensam hemma med Amadeus. Har inte riktigt hunnit ta in att jag får ha mina trosor i fred, att ingen kommer ta mina kläder eller ätit upp fetaosten när jag kommit hem från ett jobbigt träningspass. Men fy vad skönt att bara kunna lägga mina saker var jag vill och vara säker på att dem kommer finnas kvar där när jag tittar där nästa gång! Okej, nu säger jag inte att det bara är positivt att både syrrorna flyttat och jag är ensam kvar men det har inte ens gått en vecka så hitills har jag bara sett det positiva. Men snart kommer nog allt det negativa. 

VÄRLDENS GODASTE LUNCH

Och jag menar det verkligen. Eftersom jag var sjuk igår kunde jag inte följa med till mormor där det serverades middag. Som alla vet är lax min favorit rätt så mormor gjorde en matlåda till mig som mamma tog med sig hem. Det här är bland den godaste laxen jag någonsin ätit. Så fruktansvärt god! 

Har väl inprincip pluggat hela dagen och för 2 timmar sedan kom morfar hit som en räddare i nöden. Nu är arbetet äntligen klart, vet inte om jag är nöjd, om jag skrivit tillräckligt omfattande eller rätt men nu får det vara helt enkelt. Har andra saker att koncentrera mig på, som ett geografi prov på fredag och ett historia prov nästa måndag. Men med tanke på att jag annars brukar ha fullt upp alla söndagar (jobbet, träning, plugg) så är det väldigt skönt att bara ta det lugnt idag. Inte behöva göra någonting förutom att plugga. Nu måste jag iofs åka till jobbet en snabbis men annars har jag bara varit hemma idag och det har varit så skönt. Har tagit 50 doser av min medicin så jag hoppas verkligen jag är frisk till imorgon. Är ju så taggad på nya träningsschemat och min nya kost! (jag postar ett inlägg senare i veckan, håller på med det nämligen men det tar tid)

Hur har era 2013 börjat? 


TRÄNINGS SPOTIFY LISTA

Det finns människor här i världen (syftar på min mamma) som anser att ungdomar inte ska löpa utomhus med musik i öronen, just för att det tydligen ökar risken för att bli påkörd, eftersom vi har "noll-koll" på vad som då pågår i trafiken och bara är i vår egen "bubbla/värld". De som yttrar sig om sånt här kan aldrig ha varit ute och sprungit själva en tisdagskväll. ALDRIG. Att springa ensam utan musik är som att.. Nu kommer jag inte på någon bra liknelse, men jag tror ni förstår vad jag menar. DET GÅR INTE.


Därför tänkte jag dela med mig av min underbara tagga-till lista som jag lyssnar på varje gång jag tränar i min ensamhet. När jag hör vissa av låtarna blir jag seriöst helt galen och kan springa 10 mil till eller lyfta 30 reps till. 

(nu är jag så oteknisk så jag vet inte hur jag delar spotifylistan..)

Jag heter iallafall Victoria Schattauer och listan heter "TÄNK INTE KÖR BARA"

2012 SLUTADES RÄTT BRA - 2013 BÖRJADE RÄTT BRA






(Stal lite bilder från Jenny)

Godmorgon!

Känner mig bättre idag! Huvudvärken har försvunnit, däremot har jag fortfarande en irriterad hals, det typ kliar i halsen, otroligt irriterande. Hur som, mina planer för idag är att: åka och städa på pappas jobb och plugga därefter. Känner inte för något av det egentligen. Vill åka till gymmet och pröva mina nya träningskläder eller gå ut och springa med min nya super smarta mössa, men jag får helt enkelt lyssna på kroppen.

Sista dagen på lovet vilket innebar den sista sovmorgonen också. Känns overkligt att börja skolan imorgon för det här lovet har känts ovanligt långt!


Hatar det här

Huvudvärk, kom ba!!!!!!!!!!!!!!


OCH SÅ VAR DET MIDDAG IGEN


Det var gott men jag är helt ärligt inte så sugen på mat just nu. Känner mig bara allmänt trött i hela kroppen och seg. Har tagit dubbla doser av en magisk medicin som förhoppningsvis gör mig frisk tills imorgon. Jag vill så sjukt gärna träna. Något som nog inte kommer hända imorgon. Det är bättre om jag vilar till måndag och blir frisk ordentligt än att köra ett pass imorgon och bli ännu sjukare. Förhoppningsvis blir det inte värre bara. 

Åt iallafall lax till middag, första gången på jätte länge. Min favorit mat ju. Tillsammans med lite bönor, keso och sallad. Nu ligger jag bara i sängen och väntar på bättre tider, och tycker synd om mig själv. Kan det åtminstone vara något bra på tv ikväll? 

NI FRÅGAR JAG SVARAR

Vad är det för kosttillskott som du ska börja ta och vad gör dom för nytta? Kan du inte berätta lite om dom och hur du ska ändra din kost nu när du börjar styrketräna?:) kram på dig bästa du!

Svar: Jag återkommer med svar på det! :)

Skitsnygga kläder!! Vad tycker du om nötter? Kan man äta det och är det nyttigt? Isf vilka nötter? Och samma med popcorn? Vilket är bäst om nu något av det är nyttigt? 
Kan du inte berätta lite om dina nya kosttillskott?

Svar: Tack!! Nötter är bra. Mycket bättre än godis! Självklart beror det dock på vilka nötter. Var noga med att köp naturliga, tex. valnötter, hasselnötter, pinjenötter, mandlar. Undvik saltade, oljerostade, glaserade eller honungsrostade, dessa nötter bli istället som onyttiga snacks. Naturliga nötter är dock nyttigt! Det som är bra med nötter är att dem går igenom kroppen tillskillnad från godis, trots att dessa innehåller lika mycket kalorier (ibland kan nötter till och med innehålla mer), men som sagt, kaloriinnehållet luras ibland! 

Popcorn som du gör själv i kastrull med lite salt och olja på är okej, det är mycket nyttigare än micropopcorn. Popcorn du köper på bion är inte alls bra, då kan du nästan lika gärna äta en påse chips (det är dock inte lika fettbildande som chips). Popcorn innehåller dock många nyttiga ämnen (antioxidanter och fibrer) men tyvärr är popcorn väldigt näringsfattigt vilket gör att det inte kan ersättas som något du äter dagligen. Se det som ett alternativ till snacks, ett nyttigare alternativ. Men det beror helt på vilka popcorn du äter. så tänk på att poppa dina egna i kastrull om du vill ha det nyttiga alternativet :) Men nötter är bättre än popcorn!

Absolut kan jag berätta om mina kosttilskott men jag gör ett inlägg om det senare!

NYA TRÄNINGSKLÄDER I GARDEROBEN

Nu är jag ännu lite lyckligare! Har nästan fått med mig hem allt jag behöver.

- En träningstopp från nike (väldigt onödig men man kan alltid låtsas) 199 kr (halva priset)
- Träningsmössa från SOC med hål (för toffs) 149 kr
- Casall compression tights 1099 kr
- Nike free fit 3.0 träningsskor 699 kr (nedsatta från 1199 kr) 



Allt är verkligen perfekt! Tightsen sitter som en smäck, kan verkligen rekommenderas. Allt sitter på plats och dem är som gjorda för mig. Mina andra från 2XU är lite väl varma att ha inomhus (eftersom det är vintertights) så dessa kommer göra susen. Perfekta att ha på gymmet. för er som har problem att hitta tights som sitter tight där nere (jag hatar det när dem är slappa), dessa är perfekta, från topp till tå. 

Vad tycker ni? :)

LÅT MIG BLI FRISK


Har känt såhär i knappt en dag och jag har redan tröttnat. Har börjat få ont i huvudet också och har värk i hela kroppen. Tror dock det är en blandning av extrem träningsvärk och bara vanlig värk i kroppen (jag kan tex. knappt sätta mig på toalettstolen, böja mig ner eller kliva upp ur bilen). Jag hatar det här. 

Dagens tips:


Vill verkligen rekommendera den här sportaffären till er. XXL tycker jag är en av de bästa sportbutikerna i Sverige. Främst för att de säljer varor (märken) till mycket billigare priser trots att det är samma produkter! Jag ska åka dit med mamma idag för att köpa lite olika saker, får alltid med mig massor hem.. 

SJUKANMÄLD FRÅN JOBBET

Ni som känner mig vet att jag aldrig blir sjuk, verkligen aldrig. Har nog inte varit sjuk de närmaste två åren skulle jag tro. Men nu, nu känner jag det i halsen och har svårt att prata. Fan också! Förträngde det igår när jag var på jobbet (hade det lite på känn) och åkte och tränade ändå för att det gick över sen, och nu är det värre. Har tagit medicin så förhoppningsvis blir det bättre. Har verkligen ingen lust att bli sjuk. Det passar sig inte! Speciellt inte till nästa vecka då jag börjar med alla nya rutiner (träningsväg och matväg). Då ska jag vara 100% awesome! 

Så jag sjukanmälde mig från jobbet. Kändes inte som det ultimata valet att stå och prata med människor och springa runt överallt i sex timmar när jag knappt kan prata. Får stanna hemma istället och plugga.. :(

NI FRÅGAR JAG SVARAR

när du äter på gymmet efter träning, äter du maten kall? Alltså i detta fallet då kycklingen, salladen är ju alltid kall hehe :)

Svar: yesbox! ;)


Nyaste shoppingen ;)

Sådärja! Nu kan jag äntligen ha koll på att jag äter tillräckligt mycket, rätt mängd. Har köpt en matvåg från cervera (märket anders petter). Nu fattas det bara batterier..


Dagens middag: Skink/ägg omelett med sallad och broccoli


Kom hem till serverad middag idag, skönt att slippa laga mat en dag som denna. Mamma hade gjort världens godaste omelett så nu är magen glad igen :) Ikväll väntar plugget och sen ska jag för ovanlighetens skull umgås lite med pappa, vi ska se taken 2. Som jag ioförsig redan har sett.. Men den är grym så det gör inget!

Ska sova hyffsat tidigt idag för imorgon väntar jobb fån 11-17. Tråkigt nog, sedan väntar ännu mer jobb från 17.30-18.30 på pappas kontor. OM jag ska hem och äta efter. Synd bara att de närmaste dagarna på lovet kommer vara kassa, bara massa plugg. Men så går det när man skjuter upp allt till sista sekund!


Crosstraining 75 min - check!

Hell yeah! Om det var jobbigt.. Uppbyggt med uppvärmning (parvis) vilket var väldigt kul. Parade ihop mig men en jätte trevlig tjej vilket gjorde träningen ännu roligare. Sedan var det styrkestationer, olika upplägg. Viktstänger, plankan, pushups, osv. Sedan kom cardio delen och det liknade grit Cardio passet jag var på igår. Förgävligt jobbigt! Men passet var väldigt utmanande och bra! Rekommenderas! Nu har jag shoppat lite på cervera (hehehehe) och är påväg hem för MAT!


Fit for fight!

Helt klart! Kikade förbi inne på casall butiken i stan och fick åtminstone med mig den här vattenflaskan. Får gå in dit igen och kolla när jag har mer tid istället! Nu är jag påväg till gymmet istället och har tänkt kötta på riktigt rejält :) min rumpa skriker verkligen AJ och jag kan knappt böja mig ner men det blir intressant och se hur det här passet kommer gå ;)


HÄR KOMMER JAG!

Idag börjar jag med mina nya kosttillskott. Före passet, under och efter passet! Ska dessutom börja äta annorlunda, mer dvs. Kommer bli en utmaning men får bara lita på att Andreas vet vad han pratar om. Jag måste helt enkelt ta in det när han säger att jag inte kommer se några bra resultat om jag äter som jag äter nu, dvs. inga kolhydrater och för lite. Men det här året är det ett starkare jag som tittar fram så det här ska jag klara galant.

Nu väntar jobbet och sedan massa träning!


Godmorgon alla glada!


Någon är kanske gladare än mig åtminstone? :) Känner mig nämligen inte så glad idag. För det första har jag en brutal träningsvärk i rumpan och benen, passar sig inte när jag ska gå på crosstraining class i 75 minuter idag. För det andra vill jag inte jobba, det är onödigt eftersom det bara är tre timmar och kräver för mycket planering (måste packa allt nu istället för sen. Lunch, mellis, middag, träningskläder, jobbkläder osv.). För det tredje skulle jag behöva en sovmorgon för en gång skull, händer ju aldrig i mitt liv. 

Men nu ska jag sluta klaga och istället börja laga mat.

MIDDAGSDAGS

Åt middag tidigt ikväll! Somnade vid 5 till 6 tiden, och vaknade sedan upp och hoppade in i duschen. Ställde mig sedan vid spisen och lagade middag! Det blev äg blandat med kalkon ocj bönor och sallad sidan + lite keso. Super gott!

Nu har jag pluggat i ett antal timmar, minst 3 skulle jag tro. Inte klar på långa vägar men har kommit en bra bit! :) blivit inkallad till jobbet har jag också blivit så jag jobbat 12-15 imorgon. Seeegt! Nu har jag Alex och pappa precis börjat kolla på en film. De sitter båda bredvid mig med med chips, choklad och dipp och här sitter jag med mitt vatten. Hehe ;)


Man måste ta tag i det tråkiga för att kunna uppskatta det roliga


Bjuder på den här otroligt hemska bilden från idag. Hehe! 
Nu ska jag sätta igång med pluggandet. Dags för lite samhälle och geografi sådär. Känns så konstigt att behöva plugga, och ännu konstigare att det snart bara är en helg kvar innan skolan börjar igen. Vart försvann jullovet? Hatar att tiden går så fort! 

LUNCH EFTER TRÄNING:

Älska känslan när man har klarat av ett hårt träningspass och ska gå direkt och äta! Blev kycklingfilé idag till lunch, kändes som att det var dags för det nu :) 

MITT TRÄNINGS SCHEMA

Måndag: Styrketräning på gym. Bröst, biceps och mage
10 set av alla övningar med 10-15 repetitioner vardera.
- Hantelpress bröst liggandes på bänk
- Bröstpress i maskin sittandes
- Bröst flyes i pededeck-maskin sittandes
- Biceps curl rakt grepp
- Biceps hammer curl, rep eller hantel
- Mage

-----> avslutar passet med 30 minuter cardio, i form av ett cykelpass.

Tisdag: 30 minuter cykelpass + 30 minuter core. 

Onsdag: Styrketräning på gym. Ben, vader, mage
10 set av alla övningar med 10-15 repetitioner vardera.
- Knäböj i smithmaskin med bänk
- Benpress i maskin enbens
- Benspark sittandes i maskin
- Baksida ben liggandes i maskin
- Raka marklyft med stång/hantel
- Knäböj hantel mellan benen
- Vadpress sittande eller stående
- Mage

-----> Passet avslutas med 20 minuter lätt på löpband för nedvarvning

Torsdag: Styrketräning på gym. Axlar
10 set av alla övningar med 10-15 repetitioner vardera.
- Drag från midja till haka, v-grepp 
- Axelpress hammergrepp i maskin sittandes 
- Hantelpress sittandes på bänk
- Axeldrag framsida med rep, start från ben till huvudhöjd

Fredag: Cykling på morgon kl. 6.45-7.30
På håltimmen: styrketräning på gym. Rygg, triceps, baksida axlar
10 set av alla övningar med 10-15 repetitioner vardera.
- Rygg latsdrag, brett grepp sittande i maskin
- Latsdrag med v-grepp sittandes i maskin
- Triceps lutande framåt med v-grepp
- Rodd brett grepp mot bröskorgen, drag
- Triceps stående med v-grepp
- Baksida axlar i Peckdeck maskin
- Triceps sittandes i maskin

Lördag: Vila 

Söndag: 4 km löpning, därefter 1,5 h styrkegympa

GRIT CARDIO - NY KLASS PÅ SATS


Det var inte jobbigt, det var fruktansvärt. Att träna 30 minuter intensiv styrka för benen innan var inte det smartaste jag gjort. Mina ben skakade redan innan cardio passet började alltså. Det instuktören började med att säga var att förklara lite vad vi skulle göra. Han sa då att, "det kommer göra ont, ni kommer börja hosta och få ont i lungerna och er puls kommer vara uppe i 180, ben med är inte farligt." Jag var nervös, vad hade jag gett mig in på liksom.. Vi började iallafall med att ställa oss i en ring för att få upp lagandan. Riktigt bra!

Fokus låg självklart på kondition, förbränning, intensiv sådan. Redan efter första låten var alla helt slutkörda och jag skojar inte, jag kunde läsa allas tankar (inklusive mina) och vi alla trodde vi skulle dö. Det var mycket upphopp, upp, åt sidan, löpning, fram och tvärs, armhävningar, höga knän, you name it.

Jag tycker verkligen verkligen verkligen att ni som tränar på sats ska pröva på det här passet. Det är rätt krångligt eftersom det är kl 12.00 på torsdagar, men om ni kan, så missa det inte! Jag kommer tyvärr inte kunna gå på passet men när det kommer luckar såsom på lov eller liknande då kommer jag lätt gå igen.
Ni som verkligen vill se resultat och har svårt att pusha på er själva, här har ni det som passar er! 

UPP OCH HOPPA

Nu står jag i köket och taggar till för att åka till gymmet. Ska först köra lite styrka på benen själv och sedan gå på ett nytt pass som heter grit cardio. Någon av er som prövat det? nu ska jag bara göra klart min matlåda och sedan kan jag gå till bussen!


BEMÖTANDE PÅ SATS

hej, du skrev innan att du fick ett väldigt dåligt bemötande av sats, vad var det som hände egentligen?

Svar: I måndags åkte jag och Andreas till sats i sollentuna för att träna. Mest för att Andreas skulle lära mig nya övningar på maskinerna som jag faktiskt kommer använda dagligen, och dessutom för att träna sista gången. När vi kom dit förklarade Andreas att han skulle provträna med mig, och givetvis visste dem att jag är medlem. Det hon i receptionen då sa var att "ja, eftersom du har med dig en medlem så får du 50 kr rabatt och därmed kostar det 150!" Andreas och jag bara kollade på varandra som frågetecken, första gången är det nämligen alltid gratis att träna, om man vill prova på alltså. Då sa andreas att han bara skulle hjälpa mig, att han hade sitt lilla gym i Kalmar och att han bara ville visa på maskinerna som jag kommer att använda för att det underlättar. Det hon då sa var något i stilen med att han inte får använda sig av sin verksamhet här. Självklart sa han då att han inte tar betalt eller någonting, självklart. Jag förstår att sats vill tjäna pengar, att man ska använda deras personliga tränare och inte få hjälp av andra, det är det allt går ut på, men på lång sikt skulle dem tjäna på att vara lite mer personliga och behandla varje kund unikt. Sedan vräkte hon ur sig att det ingår i medlemsskapet att få hjälp med hur maskinerna fungerar också, vilket är felaktigt. Visst, dem följer väl sats regler men förlorar väldigt mycket på det. I det långa loppet. Det slutade med att vi gick därifrån och åkte till ett annat gym. Riktigt tråkigt tycker jag. Att dem är så beroende av deras märke, på hur dem ser ut utifrån. Blir bara trött. Jag har varit så nöjd med sats hela året och tyckt att det är så bra men i måndags var första gången jag blev dåligt bemött. Första gången jag tyckte servicen var dålig. Blir bara arg av att tänka på det!


Firar morfis

76 år det är inte illa det! Den mest kloka människa jag känner är du också, grattis!!

Nu har jag ätit middag hos mormor och morfar (oxfile med sallad och sparris) och är påväg med Jenny till Matilda. Så underbart!!


KOM IGEN NU DÅ


Eftermiddag med bästis

Nu har jag äntligen inhandlat en nu, otroligt nödvändig bh. Inga passar ju längre.. En fika blev det också med Jenny och lite shopping efter det. Nu är jag påväg till mormor, morfar fyller nämligen år idag så vi ska ha middag för honom!


Lunch på gymmet:


KAN INTE SLUTA LE

Känns så bra att vara tillbaka på banan igen! Träffade Patricia på gymmet så vi körde passen tillsammans. Körde riktigt hårt idag, var så brutalt lycklig och taggad!


Onsdag morgon

Fy vad jag fortfarande har ont i hela axelpartiet/överkropp. Tur att jag ska använda benen på cykelpasset idag! Har inte cyklat på nästan två veckor, i och med att passen inte varit de samma under jul och jag varit i Kalmar. Därför är jag extra taggad! Har laddat upp med frukost och gjort matlådor för idag, nu ska jag bara packa allt jag behöver i väskan. Hoppas ni får en bra dag!

KVÄLLSMYS OCH ÅTERHÄMTNING

Hade varit rena rama självmordet att bege mig till gymmet idag, vilket jag givitvis inte gjorde. Känner mig bara arg på sats som på många sätt bara är ute efter att tjäna pengar. Blir galen. Hur som helst känner jag att min kropp börjar må bättre igen och jag har inte lika ont som jag hade när jag vaknade imorse. Men som man säger "I'd rather be sore than sorry". Nu ska jag sova för imorgon väntar mycket kul. Ska upp vid nio tiden och äta frukost för att ladda för träning. vid 11.30-12.30 ska jag gå på cykling och core styrka. 30 min vardera! Efter det fika med jenny och sedan ridning + middag hos morfar som fyller år. Fullt ös! Kan inte vara gladare för att vara tillbaka på banan igen, är så taggad på känslan jag kommer ha om 3 veckor då jag tränat & ätit nyttigt i flera veckor. All julmat och grejer hoppas jag verkligen inte satt sig på kroppen för mycket. Tur att man jobbat aset av sig samtidigt som man tryckt i sig alla kalorier :) Får hoppas att det jämnat ut sig lite! 

GÅRDAGENS SMINKNING/OUTFIT


Innan jag bytte om igår (min klänning blev för tight efter för mycket roligheter) så hade jag på mig min klänning från h&m och klackar från nilson shoes. Enkelt och snyggt! Hade en svart/glittrig/guldig sminkning med lösögonfransar på och utsläppt plattat hår. Tyckte det blev jätte bra!

PLANERING FÖR DE KOMMANDE 3 MÅNADERNA


Efter en hel dag hos Emma kom mamma och hämtade mig vid 8 tiden. Har sedan dess spelat bil-spel på tv:n med Andreas och pappa, städat/packat upp allt i mitt rum, lagt upp ett träningsschema med Andreas för mig och sagt hejdå till Michaela som flyttar till Norge idag. 

I övrigt känns det knäppt att 2012 är historia och 2013 är det som gäller nu. Det gäller att kunna njuta av allt. Önskar vi människor var bättre på det, att kunna stanna upp och vara tacksamma istället för att ständigt vilja ha mer och hela tiden längta och bara blicka framåt. Jag menar, man måste kunna njuta av resan. 

Imorgon börjar slutspörten för mig och min sjukt-långa-fitness-resa-som-aldrig-tar-slut. Eller nått, typ så :) Blir så chockad när jag ser bilder eller läser om människor som kommit till "drömkroppen" på 3 månader av hårt slit, med stor viktnedgång osv. Visst att man kan åstakomma mycket på den tiden om man kör hårt, det vet jag, men ändå. För mig låter det väldigt orimligt att kunna förändra kroppen totalt på så kort tid, i mina öron låter det isåfall som något kortsiktigt och inte en förändring i livet, dvs. en ny livsstil. Snart har det gått ett år sedan jag började träna och jag menar, det är klart saker kommer ivägen. Helt plötsligt var det sommar och jag skulle till USA och leva loppan, det var väl det som stannade upp allt som mest. Och jag menar, tiden går fort, nu har det snart gått ett år och jag har ännu inte nått min "drömkropp" som jag hör att vissa kan nå på 3 månader av hårt slit. Jag tror dock inte det skulle funka för mig. Inte om jag skulle vilja förändra mig själv för resten av livet. Då behöver åtminstone min hjärna längre tid att ställa om sig, längre tid att förändras och komma in i det såkallade "nya". Och det har den gjort nu också! Men det har tagit tid, och det har gått upp och ner. Och jag har kämpat otroligt hårt. Jag har slitit som en galning. Gått upp otroligt tidigt på mornarna, blivit otroligt mer strukturerad som person, och jag orkar inte rabbla upp allt, haha. Alla dessa faktorer tar jag för givet av mig själv nu, vilket jag egentligen inte borde göra, med tanke på att för ett år sedan skulle dessa starka beslut inte tas av mig. Den Victoria var inte född för ett år sedan. Och det har krävts mycket. Inte bara lite vilja och hopp. Jag har fan behövt bestämma mig och ge fan i att jag ska klara det, jag har behövt offra mycket, jag har tvingats ändra alla mina vanor, så som sömnvanor, kostvanor och träningsvanor. Jag har behövt prioritera om och fortsätta kämpa trots motgångar, och ge mig fan i att jag aldrig ska ge upp.

Det känns som att min resa har varit så mycket längre än många andras. Men jag tror på lång sikt bara att jag tjänat på det. Att lägga ner ett år med hela min själ istället för bara 3-4 månader tror jag gör stor skillnad i det långa loppet. Jag har inte bara tränat jämt och ständigt utan också förändrat hela min syn på livet och hur jag vill leva. Det har varit en process som påverkat mig mer än jag någonsin kunnat ana. och det är just därför allt detta, det jag åstakommit betyder så mycket. Jag har lagt ner min själ i att nå mina mål under 2012. Och vi alla vet att när man går in för något helhjärtat blir man så mycket mer sårbar om man misslyckas eller stöter på motgångar. Men det gör en starkare! 

Nu har jag och Andreas lagt upp ett schema för mig hur min träning ska se ut de resterande 3 månaderna. Om ni vill kan jag lägga ut det här imorgon? Nu är jag fit for fight! Kan inte röra kroppen dock. Från midjan och upp till nacken är jag som förlamad, handikappad efter gårdagens pass. Jag har aldrig känt såhär, i hela mitt liv. Men såfort man rör på min kropp gör det ont. Såfort jag böjer bak armarna skriker jag och när jag bara rör min nacke med ett finger tror jag att jag ska gå av. Den träningen hörni, det axelpasset tog! 

Men nu är träningen verkligen strukturerad och jag har mina lappar som jag ska anteckna på under varje träning för att hålla koll på hur jag förbättras. Styrketräning är schemalagt oftare varvat med kondition, vilket ger en perfekt kombination! Känns verkligen jätte bra!! 

Hörrni, hur känner ni för 2013? Enligt mig var 2012 ett grymt bra år, för min del, jag har nog aldrig åstakommit så mycket på så kort tid. För första gången har jag inte nyårslöftet "göra något åt ångesten för beach 20..." utan jag har faktiskt tagit tag i det och jobbat aset av mig! Jag tycker att det här kan bli vårat år, 2013, och en förändring är aldrig försent att göra. Är ni med mig? 

SÅ MAN KAN SE UT!

Hoppas jag inte skrämmer bort er med den här bilden nedan. Hehehe. Efter en hård kväll resulterar det i detta ;) Men det är bara att köra all in ju. Inte festat på ett halvår och kommer nu inte festa igen på cirkus lika länge, hehe. Kändes riktigt roligt att vara tillbaka på banan igen haha :) Men nu är det andra puckar!

MITT NYÅR

Åh, jag hade en jätte bra kväll igår! Det var en super stressande dag dock. Tränade med Andreas till cirka kl 2. Sedan åkte vi till sollentuna och åt lunch efter en massa kaos med Alexandra. Sedan hem och duscha + hämta alla mina saker. Sedan hem till Ellen för att bli sminkad av michaela, bli hämtad av jennys bror och sedan åka hem till jenny och fixa klart oss och sedan till slut hem till Carro. Kaos!!

När vi kom dit väntade en 3-rätters middag med jätte mysigt folk. Allt var otroligt gott och vi hade allmänt kul hela kvällen! Vid 1 tiden skulle vi vidare på en fest och emma skulle gå på på en annan busshållsplats för att hänga på men tågen slutade gå så inget matchade.. Jag och emma åkte då istället hem till henne så sov vi där. Men det var super mysigt! :) jätte nöjd med nyår i år!

Jag vaknade upp imorse vid 12 tiden, åt frukost med emma och sen dess har vi varit här hela dagen. Jag har aldrig i hela mitt liv haft såhär ont i kroppen, efter träningen igår kan jag seriöst inte röra på mig. Känslan är så sjuk!! Det tog så otroligt mycket igår!

Som ni förstår är den här dagen till för en sak, dagen efter då det inte finns några måsten. Iallafall inte i min värld. Dagen är till för att äta och skratta och sova och bara göra allt och ingenting. Så det är precis det jag gör! :)


HAMNADE HEMMA HOS EMMA

Tillslut! Den här dagen är till för att äta så vi hörs sen ;)